Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 10000+ citations for Mouse WD repeat containing protein WRAP73 WRAP73 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... Subsequently tissues and serum were analyzed for cytokine levels using standard ELISA kits: TNF (88-7324: Invitrogen); IL-6 (R&D Systems DY406) ...
-
bioRxiv - Neuroscience 2023Quote: Measurement of Aβ1-40 levels was performed using an Amyloid beta 40 Human ELISA Kit (Invitrogen, KHB3482). For further information please see Supplementary Material.
-
bioRxiv - Bioengineering 2023Quote: ... the solution from b) and c) were collected and measured using an insulin ELISA kit (Thermo Fisher for mouse islets ...
-
bioRxiv - Cell Biology 2023Quote: ... The quantification of these pro-inflammatory cytokines was conducted by commercial ELISA kits (Invitrogen, Waltham, MA, USA), according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: Aβ40 and Aβ42 peptides levels were detected using a commercial ELISA kit (Invitrogen KHB3481 and KHB3441, respectively). Briefly ...
-
bioRxiv - Physiology 2023Quote: ... supernatant protein concentration was determined by BCA protein assay (Pierce BCA Protein Assay Kit, Cat#23225, Thermo Scientific). Twenty μg/lane was run (200V ...
-
bioRxiv - Bioengineering 2023Quote: ... Total protein concentration was determined using the Qubit™ Protein and Protein Broad Range (BR) Assay Kit (Invitrogen).
-
bioRxiv - Bioengineering 2023Quote: Protein yield: MSC-EV preparation total protein concentration was determined using the Micro BCA Protein Assay Kit (ThermoFisher) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... pellets were reconstituted in 50[µl of 0.1[N NaOH and kept for protein quantification using a BCA protein assay kit (Thermo Scientific Pierce BCA Protein Assay Kit, PI23227). Dialysate concentrations are expressed as ng/ml and tissular concentrations as ng/mg of total proteins.
-
bioRxiv - Cell Biology 2023Quote: Mouse embryonic fibroblasts (MEFs) were isolated from E13.5 mouse embryos and grown in ‘MEF medium’ containing DMEM (41966029, Thermo Fisher Scientific) supplemented with 10% FBS (10270106 ...
-
bioRxiv - Microbiology 2020Quote: ... containing a guide RNA targeting mouse CD81 (GCAACCACAGAGCTACACCT) using Lipofectamine 2000 (11668027, Life Technologies). Puromycin selection was carried out 36 hours after transfection using a 5 μg/ml solution ...
-
bioRxiv - Molecular Biology 2024Quote: We maintained mouse embryonic stem cells (E14) in ESC Media containing: DMEM (Fisher Scientific) supplemented with 15 % ESC-qualified fetal bovine serum (Thermo Fisher Scientific) ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... The concentration of IL-6 was quantified by ELISA (Human IL-6 ELISA Ready-SET-Go!, Thermofisher) by following the supplier’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... nuclear soluble and chromatin-bound protein fractions were extracted from cells using the Subcellular Protein Fractionation Kit for Cultured Cells kit (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified mouse SR was concentrated using a Pierce protein concentrator (Thermo Scientific) 10K molecular weight cut off filter ...
-
bioRxiv - Biophysics 2020Quote: ... and 10 μg/mL mouse protein laminin (Thermo Fisher Scientific 23017-015). 50 mm glass bottom dishes (WillCo GWSt-5040 ...
-
bioRxiv - Neuroscience 2021Quote: ... monoclonal mouse anti-S6 ribosomal protein (MA515123, Thermo Fisher Scientific; 1:100), polyclonal rabbit anti-RPL24 (PA530157 ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were detected using mouse monoclonal anti-Actin (Thermo Scientific, MS-1295), rabbit monoclonal anti-IFIT1 (Cell Signalling ...
-
bioRxiv - Molecular Biology 2020Quote: ... V5-tagged proteins were detected with mouse monoclonal anti-V5 antibody (ThermoFisher) at 0.3 μg/ml ...
-
bioRxiv - Genomics 2023Quote: ... 1 ug/mL Laminin mouse protein (Thermo Fisher Scientific; Cat. No. 23017015), 10 nM ROCK inhibitor ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were quantified with a Micro BCA protein assay kit (Thermo Scientific, Rockford, IL) using the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentration was adjusted using the Pierce™ BCA Protein Assay Kit (Thermo Scientific). For co-immunoprecipitation assay ...
-
bioRxiv - Cell Biology 2020Quote: ... Total protein concentrations were determined using the Pierce BCA Protein Assay Kit (ThermoFisher Scientific), before extracts were stored at −80°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were determined using a bicinchoninic acid protein assay kit (Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were estimated using the Pierce BCA Protein Assay Kit (ThermoFisher Scientific# 23227). 400-500μg of protein from the stably transfected HEK293 cells were used to immunoprecipitate FLAG-tagged MIB1 using EZview™ Red ANTI-FLAG® M2 affinity gel (MilliporeSigma# F2426 ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were determined using a Pierce BCA Protein Assay kit (Thermofisher Scientific, 23225) colorimetric reaction and quantified on a SpectraMax i3 Multi-Mode Platform (Molecular Devices) ...
-
bioRxiv - Immunology 2021Quote: ... Total protein concentration was assessed using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts of whole-cell protein lysates samples were boiled in Laemmli loading buffer ...
-
bioRxiv - Genetics 2021Quote: ... Protein amounts were determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher). Equal amounts of protein (in vitro samples ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentration was determined via the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Samples were boiled at 95°C for 5 minutes with Laemmli buffer and 20 μg of each was loaded into a 4-20% Mini-PROTEAN TGX Precast Protein Gel (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... protein concentration of lysates was measured using Pierce™ BCA Protein Assay Kit (ThermoFisher), to ensure equal loading of proteins ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein concentrations were measured using the Pierce BCA Protein Assay kit (Thermo Fisher Scientific). Cytoplasmic and nuclear samples from each brain region containing 5μg total protein was boiled in Laemmli loading buffer and run on a 4%–20% Bio-Rad precast gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... the protein content was quantified with a Pierce BCA Protein Assay Kit (Thermo Scientific). The lysate [50 µg protein/50 µL] was incubated with 0.5 µL of 1 M DTT solution at 37 °C for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... and the protein concentration was determined using Pierce BCA Protein Assay Kit (Thermo Fisher). 50 μg of protein was loaded into each lane of Mini-Protean TGX gels (Biorad ...
-
bioRxiv - Molecular Biology 2021Quote: ... the protein amount was confirmed with a BCA protein assay kit (Thermo Fisher Scientific). Proteins were reduced by treatment with 10 mM DTT for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... the protein concentration was measured using the BCA protein assay kit (Thermo Fisher Scientific). Afterwards ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration was measured with Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific), then 30 μg protein lysates were mixed with NuPAGE™ LDS Sample Buffer (4x ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration was determined with the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentration was measured with Pierce BCA Protein concentration assay kit (Thermo Fisher Scientific) on a spectrophotometer plate reader (Molecular Devices ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein content was determined with the BCA Protein Assay kit (23225, Thermo Fisher Scientific). Equal amounts of protein were resolved on gels under reducing conditions ...
-
bioRxiv - Genomics 2020Quote: ... Total protein content was quantified by Qubit™ Protein Assay Kit (Thermo Fisher Scientific). Sap containing 100 ug of protein was freeze-dried and resuspended in 5% SDS and 50mM triethylammonium bicarbonate (TEAB ...
-
bioRxiv - Genomics 2020Quote: ... Protein concentration was measured by Pierce Coomassie (Bradford) protein assay kit (ThermoFisher Scientific, 23200) and the Turner spectrophotometer SP-830.
-
bioRxiv - Immunology 2021Quote: ... Protein concentration was determined utilizing Pierce 660 Protein Assay kit (Thermo Fisher Scientific, 22662) with ionic detergent compatibility reagent (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2019Quote: ... Total protein was quantified using the Pierce Micro BCA Protein Assay Kit (Thermo Scientific). 8 µg of total protein was separated by electrophoresis on a precast 4-15% TGX gradient gel (Bio-Rad ...
-
bioRxiv - Microbiology 2019Quote: ... before measuring the protein content using Micro BCA™ protein assay kit (ThermoFisher, USA). The viral/nanoparticle corona complexes were then resuspended in PBS and adjusted with ammonium bicarbonate to a final concentration of 20 mM ...
-
bioRxiv - Microbiology 2019Quote: ... Total protein was quantitated by fluorometry using the Qbit Protein Assay Kit (Thermo Fisher). Beta-lactamase activity was determined by the addition of 80 ng nitrocefin to either 250 ng or 1000 ng of total protein ...
-
bioRxiv - Cancer Biology 2020Quote: ... protein lysates were quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Lysates were separated by SDS–PAGE and transferred to nitrocellulose or PVDF membranes using the Trans-blot Turbo Transfer System (BioRad ...
-
bioRxiv - Biophysics 2019Quote: ... protein concentrations were evaluated using a Pierce™ BCA Protein Assay Kit (ThermoFisher Scientific) and 10 µg of total protein was loaded into a 16% SDS-PAGE gel ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations were determined using a bicinchoninic acid protein assay kit (Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Protein quantification was done using Micro BCA Protein Assay kit (ThermoFisher Scientific, Waltham, MA). Ten μg of total protein from a cell lysate from AML12 hepatocytes infected with RVFV at an MOI of 3 were used as a positive control ...
-
bioRxiv - Cell Biology 2019Quote: Proteins were fluorescently labeled for microscopy using Microscale Protein Labeling kits from Thermo Scientific: Alexa Fluor™ 488 (A30006) ...