Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 10000+ citations for 6 Bromo 2 trifluoromethyl 3H imidazo 4 5 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: 293T-ACE2 and HT1080-ACE2 cells were seeded in 24-well plates and 6-well plates respectively to achieve 70% confluency after 4-6 hours and then transfected with Lipofectamine RNAiMAX (Thermofisher) using the indicated dsiRNAs (IDT ...
-
bioRxiv - Plant Biology 2023Quote: ... and 0.1% formic acid in acetonitrile (B) (A998-4, Thermo Fisher Scientific, Waltham, MA, USA). The column temperature was set to 45 °C ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, Cat # N13195) and incubated for 30 minutes in their respective culture conditions ...
-
Sapogenin based self-assembly structures activating a non-apoptotic cell death via multiple pathwaysbioRxiv - Pharmacology and Toxicology 2021Quote: 100 mg AG was dissolved in pyridine and 450 mg p-TsCl (p-Tosyl Chloride, Acros Organics) reagent was added ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-Ethynly-2’-deoxyuridine (EdU; E10415, Thermofisher) was administered to mice via their drinking water at a concentration of 0.2 mg/ml for up to 21 consecutive days (as per 58) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was administered intraperitoneally (500 µg per animal ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2-hydroxy-5-nitrobenzaldehyde (Acros Organics, #416180050 dissolved in ethanol to 120 mM and centrifuged for one minute at 15,000 rpm to remove insoluble material ...
-
bioRxiv - Neuroscience 2020Quote: ... with 5% 2-mercaptoethanol (Thermo Fisher Scientific) was added 3:1 to an aliquot of each sample ...
-
bioRxiv - Developmental Biology 2022Quote: EdU (5-ethynyl-2’-deoxyuridine) powder (Invitrogen) was dissolved in sterile PBS into a working concentration of 2.5 mg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Life Technologies) was added to a final concentration of 10 µM and incubated for 90 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2’deoxyuridine (EdU) (Life Technologies) at stated times at a concentration of 10 μM ...
-
bioRxiv - Developmental Biology 2019Quote: 5-ethynyl-2’-deoxyuridine (EdU – ThermoFisher Scientific) retention experiments were conducted to label the nuclei of cell that have undergone S-phase DNA synthesis and their progeny (Salic and Mitchison ...
-
bioRxiv - Cell Biology 2020Quote: 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen, C10418) was dissolved with 2 ml sterile PBS at the concentration of 5 mg/ml (20 mM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Life Technologies) was injected intraperitoneally (0.3 mg/10 g of mouse weight ...
-
bioRxiv - Neuroscience 2024Quote: ... EdU (5-ethynyl-2’-deoxyuridine, A10044, ThermoFisher) and Doxycycline Hydrochloride (1ug/ml ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5μM 5-ethynyl-2’-deoxyuridine (Thermo Fisher A10044 or component of Click-iT® Alexa Fluor 488 reaction kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mL Glutamax (2 mM, ThermoFisher 35050061), and 5 mL Penicillin/Streptomycin (100 U/mL and 100 μg/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mL Glutamax (2 mM, ThermoFisher 35050061), 5 mL Penicillin/Streptomycin (100 U/mL and 100 μg/mL ...
-
bioRxiv - Immunology 2024Quote: ... 5-ethynyl-2’-deoxyuridine (EdU, Thermo Scientific) was reconstituted at 5mg/mL in DPBS and injected at 50mg/kg i.p ...
-
bioRxiv - Biophysics 2023Quote: ... polystyrene microspheres (rbead=2·5 μm; Thermofisher) were used to template the glass discs in a continuous gold film ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-ethynyl-2-de-oxyuridine (EdU; ThermoFisher) was provided via intracardiac intravenous injection for chick embryos (E4 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells (2 × 105) were plated in 6 well culture dishes (Nunc™ ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI, 0.1 mg/ml, D1306; Molecular Probes) was added into the incubation solution to visualize cell nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µM DSM1,79 6 µM blasticidin-S (Invitrogen Life Technologies R21001), 5 nM WR99210 (Jacobus Pharmaceuticals) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µM DSM1,79 6 µM blasticidin-S (Invitrogen Life Technologies R21001), 5 nM WR99210 (Jacobus Pharmaceuticals) ...
-
bioRxiv - Cell Biology 2022Quote: ... DCFH-DA (6-carboxy-2′,7′- dichlorodihydrofluorescein diacetate) was from Invitrogen. DMSO and Evans Blue Dye were purchased from Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... Day 6-10 media contained 2% B27 supplement with insulin (Gibco) and BMP4 and FGF2 at previous concentrations ...
-
bioRxiv - Systems Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) containing mounting medium (Thermo Fisher Scientific). The results were detected using fluorescence microscopy (Leica ...
-
bioRxiv - Cancer Biology 2020Quote: ... 6-diamino-2-phenylindole (DAPI; Cat# D1306, ThermoFisher Scientific, Waltham, MA) to exclude dead cells and analyzed on an LSR-II Flow Cytometer (BD Biosciences) ...
-
bioRxiv - Biophysics 2021Quote: ... blotted for 2-6 s in a VitroBot (Mark IV, ThermoFisher) at 4 °C and 100% humidity ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA) staining solution and mounted with cover glass ...
-
bioRxiv - Microbiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) antifade reagent (Life Technologies, CA, USA) and sealed with nail polish.
-
bioRxiv - Pathology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA), mounted ...
-
bioRxiv - Pathology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA), mounted ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed 2-3 times (200 rpm, 5 min at 4°C) in eBioscience™ Permeabilization buffer (250 µl/well) (Invitrogen) and resuspended in eBioscience™ Fixation/Permeabilization solution (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Genetics 2022Quote: ... Ly6Chi monocytes were labeled by intraperitoneal injection of 4 mg/mL of Edu (5-ethynyl-2’-deoxyuridine) from Life technologies (NY), and mice were euthanized after 5 days to assess baseline recruitment or 21 days to assess for retention ...
-
bioRxiv - Genetics 2020Quote: ... boiled in reducing sample buffer for 5 min and resolved on 4–12% Bis-Tris Bolt gels and transferred using an iBlot 2 (Thermo Fisher). Blots were blocked in 2.5% milk in 1% TBS-Tween before staining with antibodies (Table S5) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were dissociated into single cells with TrypLETM for 4-5 minutes at 37 C and seeded into 2 % Geltrex coated 96- or 12-well plates (Fisher Scientific) in Essential 8TM Medium (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... A 3% agarose gel with 4 μL ethidium bromide was loaded with 5 μL PCR reaction and 2 μL GeneRuler 100bp ladder Plus (Thermo Fisher) and run for 40 minutes at 100 volts ...
-
bioRxiv - Microbiology 2023Quote: For detection of NO in treated mycobacteria DAF-FM diacetate (4-Amino-5-Methylamino-2’,7’-Difluorofluorescein),27 purchased from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... 20% volume of 1M 2-morpholin-4-ylethanesulfonic acid (MES) pH 5 and Immobilized Protein G resin (Thermo Scientific Prod#20397) were added to supernatant and sample was incubated overnight at 4°C ...
-
bioRxiv - Genomics 2024Quote: ... was prepared fresh with the 3’aminated 5’ caged oligo root carrying a terminal Cy3 dye (2 μM BL003 for the single-cycle experiment and 2 μM BL728 for the 4-cycle experiment) and a bifunctional crosslinker BS(5)PEG (Thermo Scientific) (5 μM in dimethylformamide) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells nuclei were counter-stained using 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) mounting medium (ProLong™ Diamond Antifade Mountant with DAPI, Thermo Fisher Scientific, Warsaw, Poland). Preparations were observed using the confocal microscope under magnification 630× and processed with Fiji software (ImageJ 1.52n ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4’,6-diamidino-2-phenylindole (DAPI) (00-4959-52, Invitrogen, Thermo Fisher Scientific, MA, USA) as counterstaining.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).