Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 10000+ citations for n4 Benzoyl 5 methyldeoxycytidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion, USA #4390824); Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab11a - 5’-CAACAAUGUGGUUCCUAUUtt-3’ (Ambion, USA #4390824); Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion, USA #4390824). The transfection of single siRNA or a combination of different siRNAs and the rescue of siRNA-treated cells with co-transfection of plasmid DNA and siRNA were completed according to the manufacturer’s (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... or 5 uM SYTO RNAselect (Thermo Fisher) was added directly to the dish for 30 minutes and then replaced with the reserved conditioned media just prior to imaging.
-
bioRxiv - Developmental Biology 2024Quote: ... 5 ml of N2 (Thermo Fisher Scientific), 10 ml of B27 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µl RNaseI (500 U, Ambion #AM2294) for 30 mins at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with 5% calf serum (CS; Gibco) and 0.1 IU/mL recombinant human follicle-stimulating hormone (GONAL-F ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 g/L ammonium sulfate (ACROS organics), 1.9 g dropout synthetic mix complete without nitrogen base (US Biological) ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... desalted on a C8 column (Acclaim PepMap, 300 μm x 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific), and separated on a C18 column (Acclaim PepMap ...
-
bioRxiv - Cancer Biology 2022Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/ml [GIBCO], Dispase 5 mg/ml [GIBCO] ...
-
bioRxiv - Microbiology 2022Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 10 minutes and blocked with DPBS containing 5% BSA and 5% normal goat serum (Gibco), for 30 mins at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5 pmol was 5’-end labeled with 20 μCi of Ψ-P32 ATP using Polynucleotide Kinase (Thermo Fisher) and subsequently purified using an Illustra MicroSpin G-50 column (GE Healthcare) ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Biochemistry 2020Quote: ... UK) with an Acclaim PepMap C18 trap column (0.3 mm × 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific). The mobile phases were A ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...
-
bioRxiv - Neuroscience 2023Quote: ... A 50μl bolus of 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected at a constant rate of 30μl/sec using a syringe infusing pump (GenieTouch ...
-
bioRxiv - Microbiology 2023Quote: ... host cells at 37°C and 5% CO2 in Dulbecco’s modified Eagle medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic Calf serum (HyClone) ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
bioRxiv - Microbiology 2023Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and LCPNS-SIIN-Cxcl1KO cells were cultured at 37°C under 5% CO2 / 5% O2 in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12 medium, Gibco) supplemented with 1% N2 (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg/ml leupeptin and 5 µg/ml E-64) and HALT phosphatase inhibitor (Thermo Fisher Scientific, Waltham, MA). Detergents were NP-40 or Brij 96V (both from Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher) at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR with primers p4 (5’ ATTTCAGTGG GACCTCAATGCC) and p5 (5’ GTGA CAGTCCAGGTGGAAACAAA) and Bpu10I digestion (Thermo Fisher Scientific #FD1184) was used to confirm the genomic differences between the KO + hTRIM28 and the KO + hTRIM28(S473A ...
-
bioRxiv - Genetics 2024Quote: ... and 5 µl were mixed with 5 µl of Power SYBR Green PCR Master Mix (Applied Biosystems Cat. # 4367659) containing 400 nM each of forward and reverse primer (S2 File) ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO], Dispase 5 mg/mL [GIBCO] ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μg total RNA were denatured for 5 mins at 95°C in RNA Gel loading dye (Thermo Scientific) before being separated on 1% agarose gels in 1X TBE (native ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neuronsbioRxiv - Cell Biology 2024Quote: ... Peptides were loaded onto a trap column (C18 PepMap100, 5 μm, 100 Å, 5 mm × 300 μm, Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2024Quote: ... The iPSCs were fed every other day and were passaged 1:5-10 every 5 days using Versene (Invitrogen). All the protocol was approved by the Medical Research Ethics Committee of Wenzhou Medical University (2017-066 ...
-
bioRxiv - Microbiology 2024Quote: ... 5′ random amplification of cDNA ends (5′ RACE) was performed using the FirstChoice RLM RACE kit (Invitrogen™, #AM1700M) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Thawed PBMCs were centrifuged (500g, 5 minutes) and the cell pellet was resuspended in 5 mL of DPBS (Gibco). Cells were counted as described above ...
-
bioRxiv - Microbiology 2024Quote: ... centrifuged at 5 000×g for 5 min at 4°C in SpinX 0,2 µm tubes (Corning, Fisher Scientific) for cell debris and bacterial removal ...
-
bioRxiv - Neuroscience 2024Quote: ... The synaptosomes were labelled with 5 µM of CellTrackerTM Green CMFDA (5-chloromethyl fluorescein diacetate; Thermo Fisher; Cat# C7025) for 30 minutes at 37°C as an internal control dye marker ...
-
bioRxiv - Pathology 2024Quote: ... according to manufacturer specifications in the presence of 10mM 5-Bromo-2’-Deoxyuridine 5’-Triphosphate (BrdUTP, Thermo Scientific, B21550), at 37°C in a dark humidified slide box for 90 minutes ...
-
bioRxiv - Physiology 2024Quote: ... 40 cycles of 95°C for 5 sec and 60°C for 60 sec using QuantStudio 5 (Applied Biosystems). The relative quantity of each gene was calculated using ΔΔCT method with 36B4 as endogenous control.
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM EDTA, 5 mM MgCl2, 1% NP-40, 0.5 mM DTT, 1X protease and phosphatase inhibitor cocktail; ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... and passaged every 3–5 days after approximately 5 minutes of incubation with 0.5 mM EDTA (15575020, Life Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free supernatants were diluted to 8 mg/mL and 5 µL of sample was combined with 5 µL of NovexTM Tris-Glycine SDS Sample Buffer (Invitrogen) to load 40 µg per well ...