Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 10000+ citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... antibody was used at 1:600 and secondary Alexa Fluor 546 anti-rabbit antibody was used at 1:500 (Molecular Probes).
-
bioRxiv - Microbiology 2021Quote: ... antibody 1:3000 in 1% PBS/BSA at 4°C followed by secondary antibody conjugated to Alexa Fluor 555 (Thermo Fisher) at 1:500 in PBS/BSA 1% was performed ...
-
bioRxiv - Cell Biology 2021Quote: ... Fixed cells were then incubated with primary antibodies for 1 hour and then for a further 1 hour with appropriate secondary antibodies conjugated with a fluorophore (Molecular Probes). The antibodies used and respective dilutions are displayed in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2022Quote: ... the membranes were incubated with anti-Sgs1 antibody (dilution 1:500) and anti-V5 antibody (dilution 1:1000, Thermo Fisher Scientific) at 4°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were carried out using iBind with 1 ug/ml primary antibodies and 1 ug/ml secondary antibodies following iBind protocol (Invitrogen/ThermoFisher).
-
bioRxiv - Microbiology 2021Quote: ... or rabbit TgALD1 antibody (1:200, kind gift from Dr. Kentaro Kato) and anti-rabbit HRP antibodies (Thermo Fisher, 1:10000) followed by development of signal with West Pico Plus Chemiluminescent Substrate (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... and rabbit anti-SERA5 (1:500) (54) primary antibodies in combination with appropriate fluorophore-coupled secondary antibodies (1:1,000; Thermo Fisher Scientific). Stainings with Lysosensor Blue DND-167 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... The membranes were washed for 15 min in TBST and then incubated for 1 h with HRP-conjugated secondary antibodies (1:5,000; Pierce Antibodies; Thermo Fisher Scientific) in TBST at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... or a major outer membrane protein (MOMP) antibody (1:1000, Novus Bio) and an appropriate AlexaFluor secondary antibody (1:200, ThermoFisher Scientific). Counterstaining was performed with Hoechst stain ...
-
bioRxiv - Neuroscience 2021Quote: ... an anti-P2X3 antibody (1:1000, Alomone APR016, anti-rabbit polyclonal) and an Alexa-488 conjugated secondary antibody (1:1000, Invitrogen A21206). The mean gray value of each DRG neuron was measured in ImageJ and a custom-made R toolkit (https://github.com/amapruns/Immunohistochemistry_Analysis ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by overnight incubation with primary antibodies (CDKL5- 1:1000, #HPA002847, Atlas Antibodies-Sigma Aldrich; NMDAR1-1:1000, #700685, Thermo Fisher; NMDAR2A-1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... DIG present on the synthesized mRNA probes was subsequently labeled with anti-DIG primary antibody (Enzo; ENZ-ABS302-0001; 1:1,000) and biotin-conjugated secondary antibody (Invitrogen; 1:500). To detect fluorescent signals ...
-
bioRxiv - Biophysics 2024Quote: ... primary stained with goat anti-Syndecan-1 antibody and mouse anti-human choriogonadotropin (β-hCG) antibody (#14-6508-82, 1:500 dilution in the buffer solution, ThermoFisher), and secondary stained as previously described ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:600) antibody was incubated at 4°C overnight followed by secondary antibody anti-rabbit Alexa 488 (ThermoFisher Scientific, 1:600) for 1h at RT ...
-
bioRxiv - Immunology 2024Quote: ... 1:500) antibodies, Alexa Fluor 546 goat anti-rabbit (#A11035, 1:500) antibodies and Hoechst 33342 (#H3570, 1:1000) from Thermo Fisher Scientific (USA) ...
-
bioRxiv - Microbiology 2024Quote: ... a rabbit anti-GFP antibody (1:2000, Yeasen Biotechnology Co., Ltd) and a Mouse anti-β-actin antibody (1:2000, Invitrogen) were added and incubated at 4°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then incubated overnight with rabbit anti-p-ERM primary antibody (1:5000, Roubinet, 2011) followed by goat anti-rabbit Alexa Fluor 488-conjugated secondary antibody (1:200, Invitrogen #A11070) for 1h ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were incubated with primary antibody (γ-H2AX, #9718, 1:200, CST, USA) and secondary antibody (AlexaFluor-555, 1:1000, Invitrogen). γ-H2AX foci were assessed with red fluorescence ...
-
bioRxiv - Molecular Biology 2023Quote: ... Incorporation of CldU was detected using rat-anti-BrdU antibodies (1:500; BU1/75, AbD Serotec) and Alexa fluor-555-labelled goat-anti-rat antibodies (1:500; Molecular Probes), whereas incorporated IdU was detected using mouse-anti-BrdU antibodies (1:750 ...
-
bioRxiv - Neuroscience 2023Quote: ... were selected and processed as described above with primary antibody Rabbit anti-Cox-2 (1:1k, Cayman Chem, 160123) and secondary antibody AF555 donkey anti-rabbit (1:200, ThermoFisher, A31572).
-
bioRxiv - Microbiology 2024Quote: ... Rabbit anti-BAG1 primary antibodies (1:1000; Carruthers Lab) and goat anti-rabbit Alexa Fluor 594 secondary antibodies (1:1000; Invitrogen; #A11012) were utilized ...
-
bioRxiv - Cancer Biology 2020Quote: ... The tissue homogenate was incubated in 10 ml digesting buffer containing 0.5 mg ml-1 collagenase type I (ThermoFisher, catalogue #17100-017) in Advanced DMEM/F12 ...
-
bioRxiv - Bioengineering 2021Quote: ... Collagen-coated surfaces were used as a native protein control and were prepared by adding 0.15 mL/cm2 of 50 μg/mL type 1 rat-tail collagen (Thermo Fisher Scientific™) in 0.02 N acetic acid (Thermo Fisher Scientific™) ...
-
bioRxiv - Immunology 2022Quote: ... The dermis part was cut into 1 mm width pieces and mixed with mixed enzyme solution containing type I collagenase (Gibco, Grand Island) and trypsin (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: Genome DNA was extracted from A431 cells (wild type, clones #1 and #2) using GeneArt Genomic Cleavage Detection Kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: Undifferentiated ESCs and all differentiated cell types were crosslinked in culture by addition of methanol-free formaldehyde (ThermoFisher, final 1% v/v), and incubated at room temperature for 10 minutes with gentle rotation ...
-
bioRxiv - Microbiology 2024Quote: ... coli type I fimbria or FliC (diluted 1:10 000 in protein-free tris-buffered saline (TBS) blocking solution (Fisher Scientific, France)) for 1 h at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... To create SiRPα-Fc fusion soluble proteins the cDNA sequence of the full extracellular domain (aa 27-371) of human wild-type allele 1 SiRPα (wtSiRPα) cDNA (Uniprot: P78324) was codon-optimized and synthesized by GeneArt (Thermo Fisher Scientific), fused with the cDNA sequence of the human hinge and IgG1 heavy chain Fc region (pFUSE-hIgG1-Fc1 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli codon optimized synthetic cDNA into pET151-D-TOPO using the respective sequences of the wild-type macrodomain-1 as templates (GeneArt, Thermo Fisher Scientific). Synthetic cDNA encoding Clostridium botulinum C2I toxin subunit was sub-cloned in pET28 as described (43).
-
bioRxiv - Cancer Biology 2023Quote: ... minced into small pieces, and digested for 1 hour in DMEM media (MilliporeSigma, catalog #D5796) containing 100 μg/ml Collagenase type IA (Gibco, catalog #17101015), 100 μg/ml Dispase II (MilliporeSigma ...
-
bioRxiv - Developmental Biology 2019Quote: ... Immunohistochemical analyses were performed on paraffin sections with traditional antigen retrieval and colorimetric development methodologies with the following primary antibodies: anti-Collagen II (Thermo Scientific, MS235B), anti-Collagen X (Quartett ...
-
bioRxiv - Genomics 2024Quote: ... Individual samples were counted with a 1:1 sample-to-trypan blue mix using an automated cell counter (Thermo Fisher Countess II FL), and resuspended to 1.50 × 106 cells per ml in PBS + 0.04% BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... We recombined these entry clones into a pDEST II backbone using LR Clonase II (Invitrogen, P/N56485).
-
bioRxiv - Neuroscience 2020Quote: Short hairpin RNAs against the mu and delta receptors were designed using BLOCK-IT RNAi Designer software (Invitrogen, USA). The sequences of the 21-nt fragments complementary to the target mRNAs were GCTGCCCTTTCAGAGTGTTAA (Oprm1-1) ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the short transcriptional variant of human DA D2 receptor with an N-terminal FLAG tag (SF-D2R-S) was inserted into mammalian expression vector pcDNA 3.1(+) (Invitrogen)62 ...
-
bioRxiv - Cell Biology 2020Quote: ... the surface receptors were labeled with 0.133 mg/ml of EZ-Link Sulfo-NHS-SS-Biotin (Thermo scientific, 21331) in PBS at 4 °C for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... and baby hamster kidney 21 cells expressing the MHV receptor (BHK-R) (32) were maintained at 37°C in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% serum (HyClone FetalClone II ...
-
bioRxiv - Neuroscience 2019Quote: Silencing lentiviral vectors were produced by co-transfecting HEK293T producing cells with lentiviral silencing plasmids GIPZ Human histamine H3 receptor shRNA (Clone V3LHS_638095 or Clone V3LHS_638091, Thermo Scientific) with packing plasmid psPAX2 and envelope coding plasmid pMD2.G (Addgene#12260 and #12259 ...
-
bioRxiv - Immunology 2022Quote: ... This master mix was added to premade 96 well TaqMan Array plates with chemokine/chemokine receptor primers (Thermo Fisher, Mouse Chemokines & Receptors Array plate ...
-
bioRxiv - Neuroscience 2019Quote: ... a cDNA encoding this receptor was cloned into the eukaryotic expression vector pcDNA 3.1(+) (Invitrogen; Cat. No. V790-20). To facilitate expression of the cloned receptor ...
-
bioRxiv - Microbiology 2021Quote: Vero cells that stably express the canine receptor CD150 (Vero-cCD150) were grown in advanced Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% (V/V ...
-
bioRxiv - Neuroscience 2024Quote: HEK293 cells were seeded in 6-well plates and transfected with 0.25μg LgBiT-miniG (miniGs or miniGsq45) or LgBiT-β-arrestin240 and 0.25μg SmBiT-tagged receptor plasmids using 3µL Lipofectamine 2000 (Thermo Fisher). 24 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: ... or a type IV DQTM collagen conjugate from human placenta (Invitrogen). Reactions were prepared in technical triplicate or quadruplicate by mixing 20 µL of substrate at 0.25 mg/mL with 80 µL of reaction buffer and 100 µL of bacterial suspension ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The type III effectors were cloned by Gateway cloning (Invitrogen, California) from the pENTR clones to the pH7WGF2 vector containing the eGFP gene (Karimi et al. ...
-
bioRxiv - Genetics 2019Quote: ... and then follicles were incubated in 0.1% Type IV Collagenase (Invitrogen) for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... The collagenase Type I (cat# 1700-017) was purchased from Gibco. All chemicals and antibodies were obtained from Sigma or Thermo scientific unless specified otherwise.
-
bioRxiv - Bioengineering 2020Quote: ... we collected each cell type and washed twice with DPBS (Gibco). We then stained cells with 10 μM dye in DPBS for 30 minutes on ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... were coated with 50 μg/ml of collagen type I (Gibco) or 20 μg/ml Fibronectin ...
-
bioRxiv - Cancer Biology 2020Quote: ... tissues were manually disrupted before incubating in collagenase type I (Gibco) and DNase (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 0.25% Collagenase Type [ (17018029, Gibco; Thermo Fisher Scientific, MA, USA) and 1% Fetal Bovine Serum (FBS ...