Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 2630 citations for 8 Benzoyloctanoicacid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and the entire set of 8 plasmids was used to transfect 293FT cells (Thermo Fisher Scientific) using Lipofectamine 2000 CD (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and 25 μg crude extract was loaded on NuPAGE™ 3-8% Tris-Acetate gels (ThermoFisher) and transferred to a polyvinylidene difluoride membrane on a TurboBlotTransfer system (Bio-Rad Laboratories) ...
-
bioRxiv - Bioengineering 2024Quote: ... HEK 293T cells were plated in fibronectin coated 8-well NUNC chambers (Thermo Scientific, Rochester, NY) at a cell density of 60,000 cells per well ...
-
bioRxiv - Biophysics 2021Quote: ... spheres were rinsed with PBS and placed into 8-well chambers (Nunc Lab-Tek, Thermo Scientific, USA) with plasma cleaned glass coverslip (MENZEL-Gläser Deckgläser 24 × 60 mm #1.5 ...
-
bioRxiv - Biophysics 2021Quote: ... spheres were rinsed with PBS and placed into 8-well chambers (Nunc Lab-Tek, Thermo Scientific, USA) with plasma cleaned glass coverslip (MENZEL-Gläser Deckgläser 24 × 60 mm #1.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Equal amounts of protein were loaded into 8% Bolt™ Bis-Tris Plus gels (Life Technologies, #NW00085BOX), separated by SDS-PAGE and then transferred to PVDF membranes ...
-
bioRxiv - Cancer Biology 2021Quote: SK-N-BE(2) and NB16 cells were seeded into 8-champer slides (Thermo Fisher Scientific, 154534) with a density of 6×103 cells/well overnight and treated with indicated treatment for 72h ...
-
bioRxiv - Cell Biology 2020Quote: ... 3×104 hTERT-RPE cells expressing mKO2-PACT were seeded into 8 well glass bottom dishes (Nunc™ Lab-Tek™ II Chambered Coverglass ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were grown in 8-well chamber slides (Nunc Lab-Tek chamber slide system, Thermo Scientific), washed and treated with 30-50 μM hydroxychloroquine for 30 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 50µl of RNA samples were pipetted into Axygen PCR 8-strip tubes (Fisher Scientific 14-222-252) and processed through PrepX protocols on the Apollo liquid handling system ...
-
bioRxiv - Developmental Biology 2021Quote: ... Ten μg of lysate was subjected to SDS-PAGE on an 8–16% Tris-glycine gel (ThermoFisher), followed by electroblotting onto an Immobilon PVDF membrane (EMD Millipore) ...
-
bioRxiv - Developmental Biology 2021Quote: ... double-stranded oligonucleotides containing eight BMP-responsive elements in tandem (8×BRE; AGATCCTCTGGTCACAGGATAATAATCCTGACGCCAGAAAGTCTGGAGGTC) were synthesized (GeneArt, Invitrogen) and introduced into the pNL3.2[Nluc_minP] vector (Promega) ...
-
bioRxiv - Pathology 2022Quote: ... as reported previously.8 Total RNA was reverse transcribed into cDNA using random primers (Thermo Fisher Scientific). Real-time PCR reactions were performed using a QuantStudioTM 12K Flex Real-Time PCR System with TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assays (probes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein samples were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) (3-8% gradient gels, Invitrogen) and subsequently transferred onto nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2021Quote: 8 TMT reagents from a 10-plex reagent kit were used to label desalted peptides (Thermo Fisher) as directed by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (male WTC11 background77) were cultured in Essential 8 (E8) Medium (ThermoFisher Scientific cat. no. A1517001) on BioLite Cell Culture Treated Dishes (ThermoFisher Scientific ...
-
bioRxiv - Pathology 2019Quote: ... Samples were analysed on NuPAGE Tris-acetate 3-8% gel (Invitrogen, Thermo Fisher Scientific, Waltham, MA, US). One μg of rhPRG4 or 22 ng CG (for endogenous CG assay ...
-
bioRxiv - Biophysics 2019Quote: ... then dissected into ~1 mm3 pieces and solubilised in 100 μL of 8 M urea (Fisher Scientific), or 3 M NaCl (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transferred into 200 µl of fresh medium in an 8-well chamber slide (Nunc(tm) Lab-Tek(tm ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mouse aortic root specimens were cut into 8 μm sections using a freezing microtome (Thermo Scientific). Some sections of aortic root were stained by oil-red O to investigate atherosclerotic lesion ...
-
bioRxiv - Bioengineering 2019Quote: ... The solution was transferred to dialysis membranes (12,000 - 14,000 molecular weight cutoff, Fisher Scientific 21-152-8), dialyzed for 1 week against DI water to remove salts and excess methacrylic acid ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with virus containing scrambled control or targeting MTR and Polybrene (8 ug/mL, Invitrogen). Cells were split after 48 h into standard RPMI-media (10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: 10,000 cells were seeded per well into an 8-well Lab-Tek II chambered coverglass slide (Nunc) 48 h prior to imaging ...
-
bioRxiv - Plant Biology 2019Quote: ... The reactions were aliquoted in 100 µL MicroAmp Fast 8-tube strips (ThermoFisher Scientific, Whaltam, MA, USA), frozen at −20°C and then lyophilized for 60 to 90 minutes in a Freezone 2.5 Liter freeze-drier (Labconco ...
-
bioRxiv - Biochemistry 2021Quote: ... The purity and concentration of p300-FLAG were assessed by 8% SDS-PAGE using BSA standards (ThermoFisher) and by western blot with an anti-FLAG antibody (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... seeded at 1.5 x 105 neurons per coverslip in Neuron Medium (8 % FBS, 2 % B-27, [Gibco, 17504-044] ...
-
bioRxiv - Cancer Biology 2020Quote: ... they were re-plated in Lab-Tek II 8-well chambers (Thermo Fisher Scientific, Waltham, MA, USA) and then treated with the appropriate drug (DMSO or TMZ 50 µM ...
-
bioRxiv - Plant Biology 2021Quote: ... 50 mM Tris-Cl at pH 8 and treated with proteinase K (100 μg/ml) (Ambion, USA) for 1 h at 55 °C ...
-
bioRxiv - Cell Biology 2021Quote: Human iPSCs (male WTC11 background24) were cultured in Essential 8 (E8) Medium (ThermoFisher Scientific cat. no. A1517001) on BioLite Cell Culture Treated Dishes (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: DH1017.IgM was run under non-reducing conditions using a NuPAGE 3-8% Tris-Acetate Gel (Invitrogen) with 1x Tris-Glycine Native Running Buffer (Novex ...
-
bioRxiv - Neuroscience 2020Quote: ... 8 sections regularly sampled across the entire dorsal striatum were mounted on SuperFrost Plus slides (Fisher Scientific) and processed exactly as described in the RNAscope assay online protocol (ACD ...
-
bioRxiv - Molecular Biology 2020Quote: ... EndoC-βH1 cells were seeded onto collagen coated 8-well chambered cover glasses (Lab-Tek, Thermo Scientific) at a density of 70,000 cells/cm2 ...
-
bioRxiv - Molecular Biology 2020Quote: Human β-cells were seeded onto collagen coated 8-well chambered cover glasses (Lab-Tek, Thermo Scientific) at a density of 70,000 cells/cm2 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then harvested and stained for 1h at room temperature with 8 μM CCF4-AM (Invitrogen) in EM medium supplemented with 2.5 μM probenecid ...
-
bioRxiv - Microbiology 2020Quote: ... About 8-15μg of total protein extract was resolved on NuPAGE 4-12% Bis-Tris gels (Invitrogen) using MES SDS running buffer (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: Patient-derived cell lines were obtained as described[8] and maintained in complete RPMI (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... United States)-coated dishes using Essential 8 flex defined medium (ref. A2858501, E8 flex; Thermo Fisher Scientific, United States), replacing it each day ...
-
bioRxiv - Bioengineering 2020Quote: ... hiPSC-Heps were trypsinized for 8-10 minutes and quenched using 80% DMEM/F12 (Thermofisher, Carlsbad, CA) with 20% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and HIEC-6 cells were seeded onto 8-well Lab-Tek glass chamber slides (Nunc, Rochester, NY) at 10,000 cells/well ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples containing 25 µg of protein were separated in 8-16% Tris-Glycine gels (Thermo Fisher Scientific) at 150 V for 45 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative PCR analyses were done in duplicate on 8 ng with PowerUp Syber Green Master Mix (Thermofisher) in an ABI Prism 7900HT Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... mycoplasma free and cultured in feeder-free conditions on Matrigel-coated plates with Essential 8 medium (GIBCO) and passaged with TrypLE™ express (GIBCO) ...
-
bioRxiv - Developmental Biology 2022Quote: ... hPSC WA09 (H9; 46XX) and derivate GPI::Cas9 were maintained with Essential 8 media (Life Technologies #A1517001) in feeder-free conditions onto Vitronectin (VTN-N ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 h egg collections were performed and animals were raised on Jazz-Mix Drosophila medium (Fisher Scientific) at 25 °C ...
-
bioRxiv - Cell Biology 2022Quote: Dermal fibroblasts of passage number 3-8 were dissociated by 0.25% Trypsin-EDTA (Thermo Fisher Scientific, 25200072), and seeded at 20K per well in the Seahorse XF96 cell culture microplates (Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... for 8 min at 37°C and later blocked using 0.5 mg/ml trypsin inhibitor (Gibco, R007100) and the suspension centrifuged for 5 min at 1000 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 50,000 cells were seeded per well in an 8-well chamber slide (Thermo Scientific) in fresh SFEM II media without additional supplements ...
-
bioRxiv - Neuroscience 2019Quote: ... 8-25 μm of protein per lane was resolved in 4-12% NuPAGE Bis-Tris gels (Invitrogen) and chemiluminescent quantitation was performed as previously described (23).
-
bioRxiv - Developmental Biology 2021Quote: ... MA)-coated plates in Essential 8 Flex medium (E8; cat. num. A2858501; Gibco, Thermo Fisher Scientific, Waltham, MA). Medium was changed daily until cells were passaged at 80-90% confluency (medium supplemented with Y-27632 [cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... MA)-coated plates in Essential 8 Flex medium (E8; cat. num. A2858501; Gibco, Thermo Fisher Scientific, Waltham, MA). Medium was changed daily until cells were passaged at 80-90% confluency (medium supplemented with Y-27632 [cat ...