Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for Ethyl 5 4 methoxyphenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... samples were heated for 5 min at 95°C and loaded on a 4-12% Tris-Glycine gel (XP04122BOX, Invitrogen). The transfer onto a PVDF membrane (IB24001 ...
-
bioRxiv - Cell Biology 2024Quote: ... or BODIPY 558/568 C12 (C12) (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (ThermoFisher, #D3835) were complexed with fatty acid-free bovine serum albumin (BSA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The pbf1 gene of johansen Standard was amplified with the primer pair psbNRO_F 5’-AGCATTGGGAGGCTCATTAC-3’ and psbNRO_R 5’-GGAAACAGCAACCCTAGTCG-3’ and cloned into to pCRTM2.1-TOPO® (Invitrogen). The vector was linearized with HindIII and in vitro transcription was performed according to the suppliers’ protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... the cultures were washed with HBSS and loaded in 5 μM Fura2-AM (108964-32-5; Life Technologies) in HBSS for 45 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg/mL plasmocin and 10 μg/mL of STI with 5 μM of CellTracker Red CMTPX (Invitrogen) for 15-20 minutes at 37°C with 0% CO2 incubator ...
-
bioRxiv - Microbiology 2020Quote: ... RdRp_rev 5’-CAAATGTTAAAAACACTATTAGCATA-3’ RdRp_probe 5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-TAMRA-3’) and/or TaqMan gene expression assays (Applied Biosystems) for ACTB (Hs99999903_m1) ...
-
bioRxiv - Developmental Biology 2022Quote: RNA was extracted from 5 pooled larvae aged 5 dpf using the PicoPure RNA Isolation Kit (Applied Biosystems). After quality control ...
-
bioRxiv - Paleontology 2020Quote: ... for 3 min at a flow rate of 10 μl.min−1 on an Acclaim PepMap100 C18 pre-column (5 μm, 300 μm i.d. × 5 mm) from ThermoFisher Scientific ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped on the trapping cartridge (PepMap100 C18, 5 μm, 5 mm × 300 μm; Thermo Scientific) prior to separation on an analytical column (Poroshell EC-C18 ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... equipped with two PepMapTM C18 μ-precolumn (0.3 mm × 5 mm, 5 µm, 300 Å Thermo Fisher Scientific) and an AcclaimTM PepMapTM analytical column (75 μm × 250 mm ...
-
bioRxiv - Immunology 2022Quote: ... and their corresponding FAM-labelled MGB probes (εGLT: 5′-AGGCACCAAATG-3′ and γ1GLT: 5 ′-CTCAGCCAGGACCAAG-3′) (Applied Biosystems) were designed in house ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’- CCACCCTCCAGCCAATC-3’ and FAM/ZEN-labeled probe 5’-ACAGGGCAACCATTGGCTCG-3’ with Taqman Gene Expression Master Mix (ThermoFisher).
-
bioRxiv - Molecular Biology 2022Quote: ... Tryptic peptides were loaded onto a trap column (Pepmap 100, 5 μM, 5 x 0.3 mm, ThermoFisher Scientific) at a flow rate of 10 uL/min using 2% ACN and 0.05% TFA as loading buffer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Viral 5’ terminal positions were determined using the 5’RACE System for Rapid Amplification of cDNA Ends (Invitrogen). To obtain 3’ ends ...
-
bioRxiv - Cancer Biology 2024Quote: ... that consisted of an µ-precolumn (C18 PepMap100, 5 µm, 100 Å, 5 mm × 300 µm; Thermo Scientific), and an analytical column (120 EC-C18 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated 1 hour with 5 μg/mL Hoechst 34580 (stock 5 mg/mL in H2O) (Thermo Fisher) and anti-mouse Alexa 647 in PBS+.
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted at -5 power for 5 s in FEI Vitrobot Mark IV (Thermo Fisher Scientific) at 4°C and 100% humidity and immediately frozen in liquid ethane ...
-
bioRxiv - Microbiology 2023Quote: The embB region containing codon 406 was amplified using PCR primers F1 5’-TGATATTCGGCTTCCTGCTC-3’ and R1 5’-TGCACACCCAGTGTGAATG-3’ designed using Primer3 (23) (version 0.4.0) and acquired from ThermoFisher Scientific ...
-
bioRxiv - Paleontology 2023Quote: ... for 3 min at a flow rate of 10 μl.min-1 on an Acclaim PepMap100 C18 pre-column (5 μm, 300 μm i.d. × 5 mm) from ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2023Quote: ... Peptides were loaded onto a trap column (PepMap 100 C18, 5 μm, 5 × 0.3 mm, Thermo Fisher Scientific) at a flow rate of 10 μL/min using 0.1% TFA as loading buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The aqueous phase was mixed with 5 µL of 5 mg/mL linear acrylamide co-precipitant (Invitrogen, AM9520) and 1000 µL of ethanol for precipitation ...
-
bioRxiv - Neuroscience 2024Quote: ... isolated cerebral microvessels (5 animals per group) or hippocampus (3-5 animals per group) using Trizol (ThermoFisher, MA) and the Qiagen RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... fitted with a µ-precolumn (C18 PepMap100, 5 µm, 100 Å, 5 mm × 300 µm; Thermo Fisher Scientific). Samples were analyzed in triplicates and separated on an analytical column (Poroshell 120 EC-C18 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 ng/mL EGF (ThermoFisher Scientific, 17005042), 50 μg/mL bovine pituitary extract (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng/mL EGF (Invitrogen, 10450-013), 7.5 μg/mL bovine pituitary extract (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... supplemented with 5% FBS (ThermoFischer/Invitrogen 10270098) and 20 nM of 20-hydroxyecdysone (Sigma H5142)(Dye et al. ...
-
bioRxiv - Genetics 2020Quote: ... 5% CO2 and cultured in DMEM (Gibco) with 10% Fetal Bovine Serum (VWR Life Science Seradigm ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 μL SybrGreen (Applied Biosystems 4309155).
-
bioRxiv - Developmental Biology 2021Quote: ... and 5% fetal bovine serum (Thermo Fisher).
-
bioRxiv - Genomics 2020Quote: ... 5 mM EDTA (Ambion, Cat. No. AM9260G), 0.4% Triton X-100 (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Glutamax (5 ml, Gibco, cat no. 35050061), Penicillin/Streptomycin (10,000 U/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μg mL-1 fibronectin (bovine, ThermoFisher), and 100 μg mL-1 hyaluronic acid (ab143634 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% sodium pyruvate solution 100 mM (Thermofisher). Undifferentiated cells were cultured at 33 °C in the presence of 10U/mL murine IFN-gamma (R&D systems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µl 10X DreamTaq Buffer (ThermoFisher #EP0703), 0.25 µl DreamTaq DNA Polymerase (ThermoFisher #EP0703 ...
-
bioRxiv - Neuroscience 2021Quote: ... and dispase II (5 U/ml, Gibco) for around 45 min at 37 °C in 5 % CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... and dispase II (5 U/ml, Gibco) at 37 °C in 5 % CO2 for 20 minutes followed by brief mechanical dissociation ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% fetal bovine serum (Gibco, #10270-106) and 50 μg/ml penicillin (HiMedia ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 μM Draq5 (Thermo Fisher, 62251) in PEM buffer for 10 minutes at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 5 mL Glutamax (35050-061, ThermoFisher Scientific), and 5 mL Penicillin/Streptomycin)] ...
-
bioRxiv - Genomics 2020Quote: ... 5 mL Glutamax (35050-061, ThermoFisher Scientific), 5 mL Penicillin/Streptomycin] ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl 20mg/ml Proteinase K (Ambion) and 4 μl 5M NaCl at 65°C for 6 hrs or overnight ...
-
bioRxiv - Genomics 2020Quote: ... supplemented with 5% FBS (ThermoFisher Scientific, USA) for 90 min ...
-
bioRxiv - Genomics 2020Quote: ... supplemented with 5% FBS (ThermoFisher Scientific, USA) for splenic tissues ...
-
bioRxiv - Immunology 2020Quote: ... polyclonal rabbit anti-claudin-5 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNase I (ThermoFisher Scientific, 5 U/ml), Benzonase® nuclease (Sigma ...
-
bioRxiv - Bioengineering 2020Quote: ... stained with 5 mg/mL DAPI (ThermoFisher) for 10 min in the dark ...
-
bioRxiv - Genomics 2021Quote: ... with 5% fetal bovine serum (ThermoFisher Scientific) and 0.5% penicillin/streptomycin (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2020Quote: ... or Alexa Fluor 488-5-dUTP (Invitrogen) using nick translation for FISH (Clarke et al. ...