Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and Toto-3 (1:1000; Thermo Fisher) as nuclear counterstain.
-
bioRxiv - Immunology 2022Quote: ... ICOS-SB436 (ISA-3, Invitrogen, 1:50), IgG-BV480 (goat polyclonal ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3% H2O2 (Fisher Scientific 7722-84-1) was used ...
-
bioRxiv - Genetics 2023Quote: ... diluted 1:3 in 1X PBS (Gibco). Trypsin was inactivated by cell media.
-
bioRxiv - Developmental Biology 2023Quote: ... or TO-PRO-3 (1:50000, ThermoFisher) for 1 hour at room temperature or overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteinase K (3 μg ml−1; ThermoFisher) digestion ...
-
bioRxiv - Immunology 2023Quote: ... claudin-3 (1:200; Thermo Fisher Scientific), claudin-15 (1:200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-3 L of Expi293F cells (ThermoFisher) were grown at 37°C to a cell density of 3.2×106 cells/mL in FreeStyle expression medium (ThermoFisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... Lipofectamine RNAiMAX (Thermo Scientific, 13778030, 1:3), FuGene HD (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... 1X N-2 supplement (Thermo Fisher, Cat # 17502-048), and 0.04 mg/mL bFGF (Stemgent ...
-
bioRxiv - Microbiology 2021Quote: ... antibodies targeting the SARS-CoV-2 nucleoprotein (N) (ThermoFisher Scientific ...
-
A critical role for heme synthesis and succinate in the regulation of pluripotent states transitionsbioRxiv - Developmental Biology 2022Quote: ... supplemented with 1x N-2 Supplement (Gibco, 17502-048), 1x B-27 Supplement (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Zoology 2022Quote: ... 2 % N-dodecyl-β-D-maltoside (Thermo Fisher scientific), 1% Igepal CA-630 (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1X N-2 MAX Supplement (ThermoFisher, 17502048), 1X GlutaMAX Supplement (ThermoFisher ...
-
bioRxiv - Systems Biology 2022Quote: ... Cytokines including: 1X N-2 (Thermo Fisher Scientific #17502048), 10 ng/ml Neuregulin ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then supplemented with 0.5% N-2 Supplement (Gibco), 1% B-27 Supplement (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... minus vitamin A N-2 Supplement (100X) (Thermo Fisher), 100 U/mL penicillin-streptomycin (Sigma) ...
-
bioRxiv - Genetics 2023Quote: ... 0.5X N-2 Supplement (100X) (17502-048, Thermo Scientific), 1X PEN/STREP 100X (15-140-122 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and N-2 supplement (1X concentration, Gibco™, 1X). Cells were seeded at a concentration of 5000 cells/well ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5x B-27 and 0.5x N-2 supplements (Gibco) to begin neuronal differentiation ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1X N-2 supplement (Thermo-Fisher Scientific, Waltham, MA), 4 µg/mL heparin (StemCell Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5% v/v N-2 supplement (17502-048, Gibco), 1% v/v B-27 supplement (17504-044 ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-pyridinemethanol (RI = 1.545, 3-PM, A10381, Thermo Fisher Scientific) were used to mix with the water-based SMLM buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... human custom-made 3’UTR HEC1 siRNA (oligo #3, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: Isolated CDX2mCherry cells (n=5) mCherry-negative cells (n=4) and hES cells (n=2 pooled) were centrifuged and 200uL Tri reagent (Thermo Fisher Scientific, USA) was added and incubated at room temperature for 15 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2) adding 25 μL of N-methyl-N-trimethylsilyltriAuoroacetamide (TMS) with 1% trimethylchlorosilane (Thermo Fisher Scientific) and incubated for 30 minutes at 60°C ...
-
bioRxiv - Cell Biology 2022Quote: ... SMPCs were switched to N2 media (containing 1% N-2 supplement (Thermo Fisher), 1% Insulin Transferrin Selenium ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 1% (v/v) HI-FBS and N-2 supplement (Gibco™). ATM knockout (KO ...
-
bioRxiv - Microbiology 2024Quote: ... and SARS-CoV-2 nucleocapsid protein (N, clone E16C, Fisher Scientific, 1:25) were diluted in blocking solution and then added and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Immunology 2021Quote: ... ENV probe (5’-/VIC/CCTTGGGTTCTTGGGA-3’/MGB, Thermo Fisher Scientific), Gag forward (5’-ATGTTTTCAGCATTATCAGAAGGA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... Pol probe (5’-/NED/AAGCCAGGAATGGATGGCC-3’/MGB, Thermo Fisher Scientific). Thermostabe DNA polymerase was made in-house by transforming E ...
-
bioRxiv - Molecular Biology 2020Quote: ... a control scrambled RNA (customed, Ambion, sense: 5’-UUCUCCGAACGUGUCACGUtt-3’) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 minute incubation with Tryple Express Trypsin (Thermo Fisher), and dilution and gentle trituration in complete media ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Cell Biology 2020Quote: ... TPD53: 5’-GUCUCCAGCAAUAGGAUGAUUUACUA-3’) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...