Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for 14 3 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Calu-3 cells were grown in DMEM (Gibco, 41966029) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... glass (2 gm, 3 mm bead diameter; Fisher Scientific) and polystyrene (24-well plates ...
-
bioRxiv - Microbiology 2023Quote: ... A volume of 3 µL DNase Inactivation Slurry (ThermoFisher) was added to each tube and samples were incubated with mixing at RT for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... coli-derived recombinant BAG1) and secondary goat anti-rabbit 594 (1:1000, Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... to enhance viral expression (primary antibody: GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... The primary (E-Cadherin [24E10] Rabbit mAB) and secondary (Goat anti-Rabbit Alexa 488) antibody was purchased form Cell Signaling Technology and Invitrogen (Thermo Fisher Scientific) respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... The blot was further evaluated for G6PD expression using primary antibody against G6PD (Rabbit mAb # A11234) and the counter labelling anti-rabbit HRP secondary antibody (Invitrogen Catalog # 31460). Chemiluminescence was capture in iBright (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... anti-His mAb (Invitrogen) and anti-GAPDH mAb (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... Caspase-3/7 activation in live cells was monitored using CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific, C10423, 1:1000) in IncuCyte Live Cell Analysis System ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2021Quote: ... The probe was biotin labeled at the 3’ end using a Pierce™ Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific Inc.). Seven micrograms of nuclear protein were added to a binding reaction mixture containing 2µl 10X binding buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... via covalent attachment to COOH groups on the particles via standard EDC chemistry using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Thermo Fisher Scientific, MA) and N-hydroxysulfosuccinimide sodium salt (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: Vero E6 and Calu-3 cells (Calu-3:ATCC HTB-55; Vero E6: ATCC, CRL-1586) were maintained in high glucose DMEM (Gibco, Waltham, MA, USA) supplemented with 10% FBS (R&D Systems ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured by caspase-3/7 staining using CellEvent® Caspase-3/7 Green ReadyProbes® Reagent (ThermoFisher Scientific Inc., cat# R37111). CHLA20 and NGP cells were grown until confluence on 6-well plates with six days of treatment with DMSO or GSK591 ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135; 10 kD BDA Invitrogen D1956; diluted in 0.9% NaCl) were used as retrograde and anterograde tracers ...
-
bioRxiv - Molecular Biology 2022Quote: ... pDNOR207-ZNF451-1 (isoform 1) and pDNOR207-ZNF451-3 (isoform 3) were generated using the Gateway® cloning BP reaction (Thermo Fisher Scientific) upon cDNA amplification using BP-tailed primers and pDNOR207 as donor vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/mL (n = 3) and 10 ng/mL (n = 3) treatment were subjected to albumin depletion according to the manufacturer’s instructions (Thermo Fisher Scientific, Loughborough, UK). Individual samples were digested with trypsin (2.5µg trypsin ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were washed in 3 times in 3% PBST (10 min) and incubated in goat anti-chicken Alexa Fluor 488 (Invitrogen, A11039, 1:1000) in blocking buffer at room temperature for 2hrs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Microbiology 2022Quote: ... pTG-Luc and SARS2-COV2 spike expression vector were transfected into HEK 293T cells at the ratio of 3:4:3 using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific, Waltham, MA). Accession IDs of the spike proteins used in the study were ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The wells were washed with 1% BSA/LBB and incubated for 1 hour with L9393 (1:5,000 dilution) in 3% BSA/LBB followed by incubation with Horseradish Peroxidase (HRP)-conjugated anti-rabbit IgG (Invitrogen, 1:5,000 dilution) in 3% BSA/LBB for 30 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... The biofilm was then washed with 3% BSA-PBS and incubated with secondary antibody (IgG horseradish peroxidase-conjugated anti-rabbit or anti guinea-pig, Thermo Scientific Singapore) at 1:500 dilution for 30 minutes and washed with 3% BSA-PBS ...
-
bioRxiv - Plant Biology 2020Quote: ... Slides were washed three times for 5 min in 1X PBS solution and then incubated for 3 h at room temperature in 100 μL blocking buffer containing Alexa 488-conjugated goat anti-rabbit secondary antibody (Molecular Probes, Invitrogen), diluted 1:200 in fresh blocking buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-β-ACTIN (AB0145-200, SICGEN, 1:1000 or 3 ug/mL) and rabbit anti-GFP (A-6455, Invitrogen, 1:1000). The secondary antibodies used were Sheep IgG (H&L ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were incubated with secondary antibody for 3 nights at 4°C with secondary antibodies at 1:500: goat anti-rabbit Alexa Fluor 488 (ThermoFisher #A-11008) and goat anti-mouse Alexa Fluor 647 (ThermoFisher #A-21236) ...
-
bioRxiv - Biochemistry 2021Quote: ... washed 3 times with blocking buffer and incubated for 2 h with Alexa 647 anti-rabbit (1/250, A21247, Thermo Fisher Scientific). After washing the cells 3 times with PBS ...
-
bioRxiv - Cell Biology 2020Quote: The following antibodies were used: anti-cleaved-caspase 3 (1:200; CST, #9664s) and secondary Alexa Fluor 647 anti-rabbit (1:500; Invitrogen, #A-20991). Reagents including EN6 (Selleck ...
-
bioRxiv - Microbiology 2020Quote: ... SIC1.301 and SIC1.300 or SIC fragments 1,2 and 3 and binding was detected using 1 in 25,000 dilution of HRP-conjugated goat anti-rabbit IgG (Life Technologies, Paisley, UK). To determine detection of SIC fragments by human purified anti-SIC antibody or antenatal serum ...
-
bioRxiv - Physiology 2021Quote: ... The wells were washed with 1% BSA/LBB and incubated for one hour with L9393 (1:5,000 dilution) in 3% BSA/LBB followed by incubation with HRP-conjugated anti-rabbit IgG (Invitrogen, 1:5,000 dilution) in 3% BSA/LBB for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... incubating with primary antibodies (rabbit anti-β-actin, 1:1000, Thermo Fisher Scientific, PA1-183; mouse anti-claudin-2, 3:500, Invitrogen, 325600 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were washed in 0.1% Triton X-100 PBS for 3 × 10 min before incubation with either donkey anti-rabbit Alexa fluor 488 (Invitrogen, 1:1000) or donkey anti-mouse Alexa fluor 555 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Sections were washed 3 x 5 minutes in PBS and stained with secondary antibodies donkey anti-rabbit Alexa Fluor 555 (1/1000, Invitrogen, A-31572) and donkey anti-goat Alexa Fluor 488 (1/1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were rinsed with PBS (3×10min) and incubated for 6 hours with secondary donkey anti-rabbit 488 antibodies (1:1000, ThermoFisher Scientific, A11006) and streptavidin 594 (1:750 ...
-
bioRxiv - Cell Biology 2022Quote: ... the slides were washed 3 times with PBS and incubated with Alexa Flour 488-conjugated goat anti-rabbit secondary antibody (Thermo Fisher Scientific) for 2 hr at room temperature ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2, Invitrogen, PA5-35115). Band intensities were measured using ImageJ software to quantify expression.
-
bioRxiv - Microbiology 2023Quote: ... The cells were then washed 3 times with washing solution and incubated with the indicated secondary antibody goat anti-rabbit: Alexa Fluor 647 (Invitrogen, A-21244) at a 1:250 dilution ...