Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 8052 citations for 7 oxo 7 phenyl heptanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... Quantitative PCR was performed on a QuantStudio 7 Flex Real-Time PCR system (Applied Biosystems). Relative gene quantification was performed using TaqMan primer probe set for LDLR (Hs01092524_m1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell number was quantified at day 7 post treatment using FluoReporter (Thermo Fisher Scientific #F2962) or PrestoBlue (Thermo Fisher Scientific # A13262 ...
-
bioRxiv - Cell Biology 2024Quote: Thermocycling was performed on the QuantStudio 7 Flex Real-Time PCR machine (Applied Biosystems, UK) using TaqMan Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged once every 5-7 days using 0.5 mM EDTA (Life Technologies, #AM9260G) in PBS-/- (Life Technologies ...
-
bioRxiv - Synthetic Biology 2021Quote: The cell lines SKBR3 and MCF-7 were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... U251 cells were treated with 4 uM CellEvent Caspase-3/7 green detection reagent (Molecular probes) prior to imaging ...
-
bioRxiv - Cell Biology 2019Quote: ... All TaqMan analysis was performed using an Applied Bio system’s Viia 7 instrument (Thermo-Fisher Scientific). The results were then exported ...
-
bioRxiv - Cell Biology 2020Quote: Cellular ROS production was measured using a CM-H2DCFDA (2’,7’-dichlorofluorescein diacetate) (Life Technologies, USA) assay kit ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 105 activated NKT cells were incubated with 1 mM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Invitrogen) in RPMI complete media for 30 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were then harvested and stained with 7-AAD viability dye and Vybrant DyeCycle Violet (Invitrogen) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from the cortices of 7-month-old mice using TRIzol reagent (Invitrogen) and RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Biophysics 2022Quote: HeLa (ECACC 93021013) and MCF-7 (ECACC 86012803) cells were cultured in MEM Alpha medium (Gibco), with GlutaMax (no nucleosides) ...
-
bioRxiv - Immunology 2022Quote: ... Frozen tissues were sectioned at 7 μm thick using CryoStar™ NX70 Cryostat (Thermo Fisher Scientific), then fixed in acetone ...
-
bioRxiv - Immunology 2019Quote: ... cells were treated with TURBO™ DNase (12 units/10^7 cells, cat# AM2239, ThermoFisher Scientific) for 1 hour at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA; Molecular Probes, Eugene, OR, USA) was used to detect NO production in sorghum genotype stalks in response to inoculation treatment at 7 DPI ...
-
bioRxiv - Physiology 2019Quote: ... 7 mg of protein were incubated with 343 μM Maleimide-PEG2-biotin (Thermo Fisher Scientific, #21901BID) at room temperature for 30 minutes with agitation by precipitating the alkylated protein with 1 mL of 100% cold acetone by incubating at −20°C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... and TaqMan Primer/Probes was run on QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher) with standard settings ...
-
bioRxiv - Cancer Biology 2021Quote: ... live zebrafish larvae (7 dpf) were incubated at 28°C in 2 mM EdU (Invitrogen, #C10340) in E3 medium for 2 h followed by a further incubation in fresh E3 medium for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... Target cell killing was measured using CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies) and analyzed by flow cytometry.
-
bioRxiv - Neuroscience 2020Quote: ... 9.4% (1.023 g/ml) and 7% (1.017 g/ml) OptiprepTM (1.320 g/ml) (Thermo Fisher Scientific). After centrifugation at 800 x g for 15 min at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... Nuclei in the actin-stained samples were labeled with propidium iodide (7 µM, Molecular Probes, P3566). The stained samples were kept in PBS and visualized with a confocal laser scanning microscope (Leica TCS SP5X with a 40× /1.1 HCX PL Apo CS lens) ...
-
bioRxiv - Biophysics 2020Quote: ... hiPSCs were dissociated by incubating at 37°C for 7 minutes with TrypLE™ Express (ThermoFisher) and seeded at 125000 cells/cm2 on a Matrigel® coated 12 well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cooled on ice before addition of 7 mL of pre-chilled phenol/chloroform (Ambion) to precipitate proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... The viability dyes DAPI and 7-AAD were used where appropriate (BD and Thermo Fisher Scientific). CellTrace Far Red (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... HBEC3-KT cells were incubated with 1 μM of 2’-7’-dichlorofluorescin diacetate (CM-H2DCFDA; Invitrogen) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCRs were run in a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH (GAPDH FWD 5’-3’= GTTCGACAGTCAGCCGCATC ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Bioengineering 2020Quote: ... and plates were read using a QuantstudioTM 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Data was analyzed using the delta-delta CT method to generate box plots for a fold change of gene expression (with a fold change of 1 representing the gene expression of 100,000 hMSCs before seeding on scaffolds and composites) ...
-
bioRxiv - Microbiology 2020Quote: ... samples were desalted using HyperSep Filter Plates with a 5-7 µL bed volume (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... A Quantstudio 7 Flex Real-Time PCR System with Fast SYBR Green Master Mix (Applied Biosystems) was used for the analysis ...
-
bioRxiv - Microbiology 2020Quote: ... bait concentration was adjusted to a target of 7 nM by dilution with Blocker casein (ThermoFisher) or concentration using a 30kDa MWCO Vivaspin centrifugal filter.
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 30 flies of 5-7 days old by TRIzol reagent (Invitrogen). The genomic template was removed using DNase (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR was then performed using the ViiA 7 RealTime PCR System (Thermo Fisher Scientific) with a TaqMan (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cultures were passaged every 5 to 7 days with collagenase type IV (Invitrogen; 1 mg/mL). The identities of all parental hESC and hiPSC lines were confirmed by DNA fingerprinting and all cell lines were regularly tested to exclude mycoplasma contaminations using a PCR-based assay ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4 old (7 months) male fish were dissected immediately into cold PBS (pH 7.4, Gibco). The dissected brains were fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Neuroscience 2022Quote: Primary mouse cortical neurons were transfected at DIV 7 using Lipofectamine LTX with Plus reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Quantification was performed by a sequence detector (ViiATM 7 Real-Time PCR System; Applied Biosystems, USA) using the TaqMan 5’ nuclease activity from the TaqMan Universal PCR Master Mix ...
-
bioRxiv - Cell Biology 2022Quote: ... 7- or 14-days post-IR sublingual glands using the RNAqueous Micro Kit (ThermoFisher Scientific, AM1931) and total RNAs were treated with DNase I (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... the solution was purified with a 7 KDa spin desalting column (ThermoFisher Scientific; Waltham, MA, USA) to obtain tetrazine-functionalized protein G (PGTz) ...
-
bioRxiv - Bioengineering 2022Quote: MCF-7 Cells were fluorescently tagged with CellTracker™ Green CMTPX dye (Invitrogen™, Waltham, MA). A stock solution of 10 mM was prepared according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... MCF-7 WT and mutant cells were cultured in Minimum Essential Media (MEM, Thermo Fisher Scientific) with 5% fetal bovine serum ...
-
Mathematical characterization of population dynamics in breast cancer cells treated with doxorubicinbioRxiv - Cancer Biology 2021Quote: MCF-7 human breast cancer cells (ATCC HTB-22) were cultured in Minimum Essential Media (Gibco) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using 2× Power SYBR green reagents on the QuantStudio 7 Thermocycler (Life Technologies).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... qPCR was carried out on a real-time PCR system (Thermo Fisher Scientific; QuantiStudio 7 Flex) using the following conditions ...
-
bioRxiv - Immunology 2022Quote: ... bone marrow cells were isolated and propagated for 7 days in 30% L929-conditioned RPMI (Gibco) containing 20% FCS (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7×106 cells were resuspended in 500 μl of PBS and crosslinked using formaldehyde (Thermo Fisher) at 1% final concentration ...
-
bioRxiv - Physiology 2019Quote: ... were used for quantitative real-time PCR (qPCR) analysis via a Quantstudio 7 platform (Applied Biosystems). Relative gene expression was assessed by normalizing CT values (dCT ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... PCR-amplified a ciRS-7 fragment was subcloned into pcDNA5 FRT-TO vector (Thermo Fisher Scientific) using BamHI and Xhol sites ...