Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cultured at 37 °C and 5 % CO2 on 4-well plates (Nunc) (300 µl/well ...
-
bioRxiv - Neuroscience 2023Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (Thermo Fisher Scientific, 90115) for 15 minutes ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were incubated with 5 µM Fluo-4-AM (Thermo Fisher scientific, Waltham, MA) along with 0.1% pluronic F-127 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 7.3) containing 5 μM of the cytosolic Ca2+ indicator Fluo-4 AM (Invitrogen, Switzerland) solubilized in Krebs solution (in mM ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... non-metabolizable glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Thermo Fisher Scientific, cat.no. 11569116). Samples were prepared as described in the section ...
-
bioRxiv - Immunology 2024Quote: The glucose uptake in ILC2 was measured using the glucose analog 2-(N-(7-Nitrobenz-2-oxa- 1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher Scientific, Catalog No. N13195) which was stored at -20°C at a stock concentration of 10 mM (5 mg lyophilised powder in 1.46 mL dimethyl sulfoxide (DMSO)) ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded in microglia differentiation medium with 3 μM Fluo-4 AM and 3 μM Fura-Red AM (Molecular Probes) in the presence of Pluronic Acid F-127 (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocks of tissue of ~3×3×4 cm (depth×width×height) were cut and prepared for sectioning using a Vibrating Blade Microtome (Thermo Fisher) at a thickness of 500μm ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed MTT (3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) assay (cat no. V13154; Thermo Fisher) for determining cell viability after different tunicamycin treatments as per the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4h in 100mm tissue culture-treated petri dishes (Fisher Scientific) with 25nM PMA (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5-aminolevulinic acid hydrochloride were purchased from Acros Organics (Fair Lawn, NJ). The 11-hydroxylauric and 12-hydroxylauric-d20 acid standards were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Biochemistry 2020Quote: ... TFA and 1 μL of this dilution and 1μL of the undiluted peptides from bands 3 and 4 were injected onto the trapping column (Thermo Scientific, PepMap100, C18, 300 μm × 5 mm), using a partial loop injection ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cultures were plated on LB agar plates containing 60 μg/mL 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal; Thermo Fisher Scientific catalogue no. R0402). Antibiotics in media for bacterial growth were used at the following working concentrations ...
-
bioRxiv - Immunology 2024Quote: ... anti-ɑ-tubulin (B-5-1-2; Invitrogen), Alexa Fluor 488 anti-acetylated tubulin (6-11B-1 ...
-
bioRxiv - Genetics 2021Quote: ... containing a 4:1:1 mixture of Lipofectin transfection reagent (ThermoFisher Scientific), water and BAC DNA (~ 15 μg DNA per larva) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Immunology 2021Quote: ... The supernatant was then nutated overnight at 4 °C with 1 ml of Protein G Sepharose 4 Fast Flow slurry (Invitrogen) per 25ml of supernatant ...
-
bioRxiv - Neuroscience 2020Quote: ... free-floating coronal hippocampal slices of 50 µm thickness were produced and incubated overnight in staining solution (4% normal goat serum, 0.4% Triton-X 100 and 4% BSA) with anti-GFAP antibody (1:1000, ThermoFisher, rat) and anti-Iba1 antibody (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: Handpicked islets (~180) from control (n=4) and diabetic (n=4) mice were placed into 1 mL Trizol (Cat# 15596018, Ambion) and processed for RNA extraction ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% (KCL-22, K562, REH, NB-4) or 20% (MOLT-4, OCI-AML3, MOLM-13, Kasumi-1) fetal bovine serum (Gibco) and 1% penicillin–streptomycin (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... tissues were washed 3x for 1 hr in adult brain wash solution and incubated overnight at 4°C or for 4 hr at room temperature with AlexaFluor488 anti-rat (1:250) (Invitrogen) and DAPI (1:250 ...
-
bioRxiv - Microbiology 2023Quote: ... 500µl of the reaction mixture was added to the cells, incubated for 4h at 37°C, and then overlaid with 2% bactoagar (214010, Becton, USA) in MEM (2X, Gibco). Plaque formation was allowed for 36-48 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... pRSV-Rev = 5: 3: 2) were co-transfected into HEK-293T cells at a ratio of 1:1 using lipofectamine 3000 (Invitrogen, USA, Cat: #L3000015). After 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... An imaging window was constructed from three layers of microscope cover glass (1 x 5 mm, 2 x 3 mm diameter, Fisher Scientific, no. 1) joined with a UV-curable optical glue (NOR-61 ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Cat. A638729) were purchased from Aladdin (Shanghai). KLH (Cat. 77600) was purchased from ThermoFisher. Peptide synthesis was conducted by Genscript (Nanjing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher) at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... centrifuged at 5 000×g for 5 min at 4°C in SpinX 0,2 µm tubes (Corning, Fisher Scientific) for cell debris and bacterial removal ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended in MACS buffer containing 2 µg/mL 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies). A BD FACSAria III Cell Sorter (BD Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell nuclei were counter stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml; Molecular Probes) prior to mounting onto glass slides and then cover slipped with ProLong Gold (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: For nuclei and F-actin staining were visualized with 4’,6-diamidino-2-phenylindole (DAPI) (#D523, Dojindo; 1:1000 dilution) and phalloidin Alexa Fluor plus 405-conjugated (#A30104, Invitrogen; 1:400 dilution), phalloidin ATTO 565-conjugated (#94072 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse HMB45 (1:20; 4°C overnight; Life Technologies, 081050). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg/mL of FM 4-64 Dye (ThermoFisher, T13320) was contained in agarose media ...
-
bioRxiv - Biophysics 2022Quote: ... and 4 µM Oregon Green 488 BAPTA-1 (Fisher Scientific) in extracellular buffer for 30 minutes at 37 °C ...
-
bioRxiv - Systems Biology 2022Quote: ... mixed in a 4:1 ratio with M199 (Thermofisher, 41150020), 10% (v/v ...
-
bioRxiv - Microbiology 2024Quote: ... containing 4% FCS and 1% L-Glutamine (L-Gln; Invitrogen). These adherent cells were cultured to confluence for five days at 37 °C in an atmosphere containing 5% CO2.
-
bioRxiv - Neuroscience 2024Quote: ... and rabbit anti-synaptophysin Ab-4 (Fisher Scientific, 1:100). Samples were washed extensively with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... the fluorescent Ca2+ indicator Fluo-4-AM (1:500; Invitrogen), and 20% pluronic acid F-127 (1:500 ...
-
bioRxiv - Biophysics 2023Quote: ... Sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (Thermo Fisher, A39268) (Sulfo-SMCC ...
-
bioRxiv - Neuroscience 2023Quote: ... and processed at 4°C with NeuroTrace (1:500, Invitrogen) in PBS containing 0.3% Triton-X ...
-
bioRxiv - Molecular Biology 2024Quote: ... oligodendrocytes were loaded with 1 μM Fluo-4 AM (Invitrogen) in culture medium for 30 min at 37°C and then washed ...
-
bioRxiv - Immunology 2024Quote: ... and 1 μg/mL αIL-4 (Invitrogen, 14-7041-85) for 3 days for CD4 cells ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and processed at 4°C with NeuroTrace (1:500, Invitrogen) in PBS containing 0.3% Triton-X ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were incubated with secondary antibody for 3 nights at 4°C with secondary antibodies at 1:500: goat anti-rabbit Alexa Fluor 488 (ThermoFisher #A-11008) and goat anti-mouse Alexa Fluor 647 (ThermoFisher #A-21236) ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissue was washed in warm PBS and incubated in pre-warmed Buffer 1 (PBS 93%, 0.5M EDTA 3%, RNA secure 4%, Thermo Fisher Scientific, Australia), at 37°C on a shaker for 10 minutes ...