Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 6523 citations for Recombinant Human PRMT3 GST tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The His-tagged proteins were blotted using anti-6x His tag HRP-conjugated monoclonal antibody (Invitrogen, USA) and detected using Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Flag tagged proteins were immunoprecipitated from 2-3mg cellular extracts with Pierce Anti-DYKDDDDK Magnetic Agarose (Invitrogen). Beads were washed 5x with 1ml IP lysis buffer end eluted with 50µl 1xLaemmli buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μg of Flag-Strep-Strep-(FSS)-tagged LRRK2RCKW cDNA and Lipofectamine 2000 reagent (ThermoFisher Scientific, USA) were used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... while non-Avi tagged antigens were biotinylated chemically using EZ-Link Sulfo-NHS-Biotin (Thermo Fisher, A39256). VH and VL sequences of SARS-CoV-2 control antibodies (COV2-2196 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cross-absorbed secondary antibodies tagged with Alexa-fluorophores were diluted in blocking buffer (1:400, Invitrogen, Switzerland) and applied for 30 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... The His-tagged proteins were purified with the HisPur Ni-NTA Resin (Thermo Fisher Scientific cat.# 88221). After washing by wash buffer (25 mM Imidazole ...
-
bioRxiv - Immunology 2023Quote: ... Hexahistidine-tagged proteins were then detected using mouse anti-6xHis tag antibody (Ma1-135, Invitrogen, Karlsruhe, Germany) as primary antibody and signals revealed by horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (ab6789 ...
-
bioRxiv - Immunology 2023Quote: ... Filtered supernatants containing His-tagged proteins were passed slowly through HisPur Ni-NTA Resin (Thermo Fisher 88221) beads in columns ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein A-tagged strains were immunoprecipitated with Rabbit IgG-conjugated (MP-Biomedicals, SKU 085594) Dynabeads (Invitrogen, 14301) (Vakiloroayaei et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... IPs of FLAG-tagged PRRC2B and PRRC2B fragments were performed using anti-DYKDDDDK Magnetic agarose (ThermoFisher Scientific). Beads were mixed with 70 μl of SDS loading buffer (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by incubation with fluorescence-tagged secondary antibodies (Molecular Probes Alexa series, all 1:400 in PBS) for 1h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were incubated with Alexa Fluor 555 tagged donkey-α-rabbit secondary antibody (1:1000; Molecular Probes) and Alexa Fluor 488-tagged donkey-α-goat secondary antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Biotin-tagged DNA nicks were visualized using Alexa488-or Alexa647-conjugated streptavidin (Molecular Probes, diluted 1/1000) during the incubation with the secondary antibody.
-
bioRxiv - Biochemistry 2023Quote: ... The His tag was digested during 14h at 4°C with histidine-tagged 3C proteases (Thermo Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: MDA-MB-231 clones H2 and C10 carrying endogenously tagged HiBiT-cIAP1 were generated by Thermo Fisher and were used for compound screens ...
-
bioRxiv - Cancer Biology 2023Quote: ... His-tagged FH(44-511) was purified from the lysate using HisPurTM Cobalt Spin Columns (Thermo Fisher). Columns were washed using with buffer A (50 mM sodium phosphate pH 7.4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were next incubated with AlexaFluor-555 tagged donkey-α-rabbit secondary antibody (1:1000, Molecular Probes) for one hour and imaged with a Nikon Eclipse 90i or a Nikon Eclipse Ti2 inverted microscope ...
-
bioRxiv - Biochemistry 2023Quote: ... FLAG-tagged ARL15 proteins were immunoprecipitated using 50 μL of Pierce Anti-DYKDDDDK Magnetic Agarose (ThermoFisher Scientific) for 2 hours at 4 ºC ...
-
bioRxiv - Synthetic Biology 2023Quote: All RBD antigens were His-tagged and purified using HisPur Ni-NTA resin (Thermo Fisher Scientific, 88222). Cell supernatants were diluted with 1/3 volume of wash buffer (20 mM imidazole ...
-
bioRxiv - Neuroscience 2023Quote: ... The nucleotide sequence encoding the histone H2B-tagged GFP was designed and ordered via GeneArts (ThermoFisher Scientific). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... His8-tagged TGM2 was first pulled down by BSA-blocked Ni2+-NTA agarose beads (Thermo Fisher Scientific). Next ...
-
bioRxiv - Cell Biology 2024Quote: ... TwinStrep-tagged proteins were concentrated using 30K MWCO concentrators to ∼ 5 mg/ml (Thermo Scientific™, USA). Protein was stored at −80°C.
-
bioRxiv - Developmental Biology 2024Quote: ... inserts were then subcloned into pCS2+ N HA tagged vectors that had been converted into Gateway (Invitrogen) destination vectors ...
-
bioRxiv - Cell Biology 2024Quote: HEK cells and zebrafish samples were tagged with TMT10plex™ Isobaric Label Reagent Set (Thermo Scientific, #90111), and fibroblast cells with TMTpro™16plex Isobaric Labels (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 and MS2-tagged HEK293:24xMS2-NEAT1 cells were cultured in Dulbecco’s modified eagle’s medium (DMEM, Gibco) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... They were then transfected with Halo-tagged gene constructs using Lipofectamine LTX (Thermo Fisher Scientific, MA, USA). After 48 hours ...
-
bioRxiv - Immunology 2024Quote: ... FLAG-tagged constructs were PCR amplified with Gateway adapters and cloned into pDONR221 using BP Clonase (Invitrogen). Hoil1 and Hoip mutations and deletions were generated using the Q5 site-directed mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...