Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 8540 citations for Lupatadine fumarate EP Impurity C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: 293T cells were maintained at 37°C/5%CO2 in RPMI-1640 (Gibco #11875093) supplemented with 10% fetal bovine serum (Gibco #10091148 ...
-
bioRxiv - Cancer Biology 2021Quote: ... overnight at 4°C and secondary antibody 1/200 anti-IgG-Alexa568 (A11036, Thermofisher) during 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated in a 60°C water bath (model FSGPD28, Fisher Scientific®, Canada) for up to 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The c.46-47CA>TG (p.S16H) variant was generated by site-directed mutagenesis (Invitrogen) using the following primers ...
-
bioRxiv - Biophysics 2020Quote: ... The slides were then incubated overnight in 60°C citrate buffer (ThermoFisher; Waltham, MA) for antigen retrieval ...
-
bioRxiv - Immunology 2020Quote: ... added to 1 ml of pre-warmed (65°C) TRIzol reagent (Invitrogen; CAT # 15596026), and frozen at −80°C overnight ...
-
bioRxiv - Immunology 2020Quote: ... Samples were incubated at 95°C with NuPAGE sample reducing agent (Thermo Fisher Scientific) and 4X NuPAGE LDS sample buffer (diluted to 1X ...
-
bioRxiv - Cell Biology 2021Quote: ... France) and cultured at 37 °C in 5% CO2 in Gibco Opti-MEM (Invitrogen), plus 10% fetal bovine serum and 1% penicillin/streptomycin.
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C and 100% humidity in a Vitrobot Mk IV (Thermo Fisher Scientific). Sample excess were removed by blotting for 3 s using a blot force of 0 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were maintained at 37°C/ 5% CO2 in RPMI 1640 Medium (Gibco) supplemented with 10% FBS and 2% Penicillin/Streptomycin ...
-
bioRxiv - Immunology 2021Quote: ... 94°C 5 min) with 4 μl of RNA and random hexamers (Thermofisher scientific). A PCR was further performed based on the protocol established by Tiller et al (Tiller et al. ...
-
bioRxiv - Immunology 2020Quote: ... Cells were incubated at 4 □C for 15min with Aqua viability dye (Life Technologies) and then subsequently incubated at 4°C for 30 min with either control isotype Ab or appropriate surface marker (MerTK ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C and supernatant was quantified with enhanced BCA protocol (Thermo Fisher Scientific, Pierce). Equivalent amounts of proteins were separated on an SDS-page (in general 20 μg increased to 50 μg for pSTAT1 Y701 evaluation after IR treatments ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells were grown at 37°C and 5% COand passaged in DMEM (ThermoFisher #10566016) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... were grown at 37°C with 5% CO2 in DMEM (Fisher Scientific, Waltham, USA), supplemented with 10% Fetal Bovine Serum (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was treated with DNAse I for 30 minutes at 37°C (Ambion DNA-free DNA Removal kit ...
-
bioRxiv - Genetics 2020Quote: ... on a StepOnePlus Real-Time PCR machine (Applied Biosystems; Tanneal -55°C; 44 cycles). The mean RNA levels were calculated by the ΔΔCt method (64) ...
-
bioRxiv - Developmental Biology 2020Quote: Drosophila S2R+ cells were maintained at 25°C in Schneider’s media (Life Technologies, #21720024) supplemented with 10% (vol/vol ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μg of mammalian expression vector plasmids based on pEF1α V5 His C (Invitrogen) encoding codon-optimized gH ...
-
bioRxiv - Physiology 2020Quote: ... MitoTracker Red CMXRos (5 μM, 30 minutes, 37°C) (Molecular Probes, Invitrogen, Paisley, UK), or TMRM (Tetramethylrhodamine ...
-
bioRxiv - Physiology 2020Quote: ... MitoTracker Red CMXRos (5 μM, 30 minutes, 37°C) (Molecular Probes, Invitrogen, Paisley, UK), or TMRM (Tetramethylrhodamine ...
-
bioRxiv - Molecular Biology 2020Quote: ... hybridization was performed at 35°C for 12 h in UltraHyb-Oligo buffer (Ambion) containing desired probes (Pseudo_GlyGCC_10 – TACCACTGAACCACCAATGC ...
-
bioRxiv - Physiology 2020Quote: ... or TMRM (Tetramethylrhodamine, methyl ester; 10 nM, 37°C) (Molecular Probes, Invitrogen, Paisley, UK). Following treatment ...
-
bioRxiv - Physiology 2020Quote: ... or TMRM (Tetramethylrhodamine, methyl ester; 10 nM, 37°C) (Molecular Probes, Invitrogen, Paisley, UK). Following treatment ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 5 min at 37 °C with pre-warmed TrypLE 1X Express (Gibco), fixed for 10 min at room temperature with 1.6% paraformaldehyde (PFA ...
-
Low-cost drug discovery with engineered E. coli reveals an anti-mycobacterial activity of benazeprilbioRxiv - Synthetic Biology 2021Quote: ... cooled to 4 °C and lysed with 10 mL B-PER reagent (ThermoFisher 78248) and a standard EDTA-free protease inhibitor cocktail (Merck 11873580001).
-
bioRxiv - Microbiology 2020Quote: Sf9 cells were cultured at 27°C in Grace’s medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... and anti-human AlexaFluor 647 (1:500, 30 minutes, 4°C; Life Technologies, A21445), and resuspended in CellFix (1:10 in water ...
-
bioRxiv - Biophysics 2020Quote: ... Both cell lines were maintained at 37°C and 5% CO2 in DMEM (Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... on a StepOnePlus Real-Time PCR machine (Applied Biosystems; Tanneal=55°C, 44 cycles). ALG9 was used as an internal control ...
-
bioRxiv - Genetics 2020Quote: Drosophila S2R+ cells were cultured at 25°C using Schneider’s media (21720-024, ThermoFisher) with 10% FBS (A3912 ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4 °C and detected with Alexa-488-labeled secondary antibody (Life Technologies). Images were taken using a Zeiss inverted fluorescent microscope ...
-
bioRxiv - Cell Biology 2020Quote: ... overnight at 4°C and with secondary antibodies Alexa488 (1:500, Invitrogen Molecular Probes), Alexa568 (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... overnight at 4°C and with secondary antibodies Alexa488 (1:500, Invitrogen Molecular Probes), Alexa568 (1:500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were stained for 1 hour at 37° C with Vybrant DyeCycle Violet (ThermoFisher) at a concentration of 10 μM in the dark ...
-
bioRxiv - Biochemistry 2021Quote: ... All primers had melting temperatures of 58-60°C (Primer Express 3.0, Life Technologies).
-
bioRxiv - Biochemistry 2021Quote: ... Hybridization was performed overnight at 42 or 68 °C in ULTRAHyb hybridization buffer (Ambion). Membranes were then washed and exposed overnight onto imaging plates and imaged on Typhoon phosphorimager (GE) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by laminin (Thermo Fisher 23017015, 1-2hr at 37°C, 2 μL/well) overnight at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... at 37°C/5%CO2 and resuspended in E8 basal medium (ThermoFisher #A15170-01), supplemented with primocin (0.1 μg/ml) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Explant were cultured at 37°C in 5% CO2 atmosphere (Thermo Scientific Midi 40), either during 24h for the Japanese quail (i.e. ...
-
bioRxiv - Biochemistry 2021Quote: ... and a 10 s extension at 72 °C using Phusion polymerase (Thermo Fisher Scientific). The resulting TGIRT-seq libraries were then cleaned up by using 1.4x Ampure XP beads to remove residual primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then resuspended in 37°C Opti-MEM Reduced Serum Medium (Gibco).
-
bioRxiv - Cell Biology 2021Quote: ... 0.25% Gtx and 0.5% Penicillin and Streptomycin at 37°C (Gibco, Carlsbad, United States) under hypoxic conditions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and either stored at −80°C after RNAlater treatment (Thermo Fisher Scientific, Waltham, MA) or processed immediately for RNA ...
-
bioRxiv - Genetics 2021Quote: ... which were dissected out and stored at −20°C in RNAlater stabilisation reagent (Ambion). All RNA dissections were carried out during a fixed time window to avoid circadian variation (Espnspdz ...
-
bioRxiv - Genomics 2020Quote: ... at 4°C and washed twice with ice cold HBSS (ThermoFisher, Cat. N: 14025092). After the final wash cells were resuspended in PBS with 1% BSA (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... Sertoli cells were maintained at 32°C with 5% CO2 in DMEM/F12 (Gibco) supplemented with 10% heat-inactivated FBS ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% heat-inactivated (30 min at 56°C) bovine calf serum (Gibco), 100 U of penicillin per ml ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented for 15 minutes at 70 °C using RNA Fragmentation Reagent (Ambion) using manufacture protocols ...
-
bioRxiv - Microbiology 2021Quote: ... coli strains were incubated aerobically at 37°C in Luria Bertani broth (LB, Affymetrix) supplemented with chloramphenicol at 15 µg/mL or 50 µg/mL kanamycin when required ...