Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 3080 citations for GPX6 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... siRNAs were transfected into D2A1 cells using Lipofectamine RNAiMAX (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The siRNA and LipofectamineTM RNAiMAX transfection reagent (ThermoFisher Scientific, 13778150) were diluted in Opti-MEM (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... transfected with 40nM siRNAs (Supplemental Table S1) using RNAiMAX (Invitrogen), incubated in growth media for 24h ...
-
bioRxiv - Cell Biology 2024Quote: siRNA transfection was performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific) with siRNAs (SASI_Hs01_00069342 for Orc6 ...
-
bioRxiv - Cell Biology 2024Quote: ... A non-targeting siRNA pool (Thermo Scientific, Supplementary Table 1) was used as a control ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 nM of siRNA pools (Thermo Scientific, Supplementary Table 1) were added to 50 μL of Opti-MEM (Gibco/Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... deletion of endogenous protein using siRNA (4392420-s28851, ThermoFisher Scientific) and rescue experiments were performed using jetPRIME® (Polyplus Transfections ...
-
bioRxiv - Cell Biology 2024Quote: ... The siRNA constructs were diluted in Opti-MEM medium (Gibco), and transfection was performed with Lipofectamine RNAiMAX Reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: siRNAs were transfected with Lipofectamine (Invitrogen Cat No. P/N50470) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... whereas siRNA was delivered using Lipofectamine™ RNAiMAX (ThermoFisher Scientific) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: BDNF knockdown was performed using either Silencer® Select siRNA targeting BDNF or a nontargeting Silencer® Select siRNA as a control (Thermo Fisher Scientific, USA). siRNA transfections were performed at a final concentration of 50 nM ...
-
bioRxiv - Cell Biology 2023Quote: ... Then the cells were transfected with 10 nM of Arp2 siRNA (Dharmacon reagents, ACTR2 Gene 10097) and control siRNA (Thermo Fisher Scientific, Silencer Select, 4390843) using siLenFect lipid reagent (Bio-Rad,1703361) ...
-
bioRxiv - Cell Biology 2024Quote: ... Silencer® Select N°1 negative control siRNA or predesigned Silencer® Select siRNAs for ZNF827 (s45694, s45695, s45696) (Thermo Fisher Scientific, Waltham, MA, USA) were used for the transfection process ...
-
bioRxiv - Cancer Biology 2022Quote: ... the RNAi screen targeting 10,415 druggable genes (three individual siRNAs per gene) was conducted using OV90 cells and the Silencer® Select Human Druggable Genome siRNA Library Version 4 (Ambion Thermo Fisher Scientific, Waltham, MA), in absence or presence of bardoxolone methyl ...
-
bioRxiv - Cell Biology 2022Quote: Transient genetic silencing of HOIP and FLOT1/2 was performed by reverse transfection of HT-29 cells with the following siRNAs: human siHOIP (RNF31) (Silencer® Select siRNA #1 s30108, #2 s30109, #3 s30110, 40 nM) (Thermo Fisher Scientific, Waltham, MA, USA), human FLOT1 (ON-TARGETplus Human FLOT1 siRNA SMART POOL ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected with 40□nM siRNAs (Ambion Stealth RNAi, Thermofisher) targeting PARP1 (sequence 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 30 nM CENP-C siRNA was transfected using Lipofectamine RNAiMax (ThermoFisher) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Transfection of siRNA was carried out using Lipofectamine RANiMAX reagent (Thermofisher), 72 hours in advance of drug treatment.
-
bioRxiv - Cell Biology 2020Quote: ... siRNA in combination with Lipofectamine RNAMAX Transfection Reagent (1:1150; Invitrogen) and optiMEM (1:6 ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA-transfected cells were incubated with 10 µM EdU (Thermo Fisher) for 30 min before harvest ...
-
REEP4 is recruited to the inner nuclear membrane by ELYS and promotes nuclear pore complex formationbioRxiv - Cell Biology 2020Quote: ... siRNAs were transfected concomitant with cell seeding using Lipofectamine RNAiMax (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or a non-targeting control silencer select siRNA (Cat# 4390846, Invitrogen), as described previously (3) ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs (148 pmol) were used: HDAC4 (CCACCGGAAUCUGAACCACUGCAUU, Invitrogen Stealth), MAVS 1 (CCACCUUGAUGCCUGUGAA) ...
-
bioRxiv - Cell Biology 2020Quote: Transfection of siRNA was performed with Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) according to the manufacturer’s user protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections of siRNA were carried out with Oligofectamine (Thermo Fisher Scientific), according to the manufacturer’s instructions and control cells were transfected with ON-TARGETplus Non-targeting siRNA #1 (D-001810-01 ...
-
TSG101 Associates with PARP1 and is Essential for PARylation and DNA Damage-induced NF-κB ActivationbioRxiv - Molecular Biology 2021Quote: The screening was performed with a genome-wide siRNA library (Ambion SilencerR Human Genome siRNA library v3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... or negative control siRNA (si-Ctrl, Cat # AM4611, Thermo Fisher Scientific). siRNA knockdown was confirmed by RT-qPCR and Western blot of cells collected 48-72 hours after transfection.
-
bioRxiv - Developmental Biology 2021Quote: ... mouse TNPO2 (s102754) and a control siRNA (4390843) from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Transfection of siRNAs has been carried out using RNAiMax (Life Technologies) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA transfections were performed using RNAiMAX lipofactamine reagent (Thermo Fisher Scientific), according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... A mixture of 40 pmol siRNA and 24 μl RNAiMAX (Invitrogen) were prepared with OptiMEM medium in a final volume of 160 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... ILK and control siRNAs were from Ambion (Foster City, CA, USA). Fibronectin siRNA was custom-synthesized by Eurogentec (Liège ...
-
bioRxiv - Cell Biology 2022Quote: siRNA knockdowns were performed using Lipofectamine RNAiMAX (Thermo Fisher Cat # 13778075) according to Manufacturer’s protocol for 48 hours ...
-
bioRxiv - Immunology 2022Quote: ... or 10 nM of the negative control Silencer® siRNA (Ambion) was transfected into the cells using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... or 2 nM of the negative control Silencer® siRNA (Ambion) for 2h at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: All Silencer Select siRNA oligos were purchased from Ambion (Life Technologies). For CASP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5nM siRNAs were separately pre-incubated with Opti-MEM (Gibco). Lipofectamine 2000 and siRNAs were left to complex for 20 minutes at room temperature and added to the plated BV2 cells in low glucose DMEM supplemented with 5% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... Stealth RNAi™ siRNA negative control med GC (Thermo Fisher Scientific) was used.
-
bioRxiv - Cancer Biology 2019Quote: ... Knockdown of PXN was achieved by siRNA purchased from Life Technologies Corporation (Cat # ...
-
bioRxiv - Cell Biology 2019Quote: siRNAs were ordered from Thermo Fisher (sequences listed in Table S4). Cells were grown to ∼70% confluence in 6-well plates in Complete Fibroblast Medium ...
-
Differential turnover of Nup188 controls its levels at centrosomes and role in centriole duplicationbioRxiv - Cell Biology 2019Quote: ... siRNAs were diluted in 500 μl of optiMEM (Thermo Fisher Scientific) to a final concentration of 30-50 nM (optimized by Western blot ...
-
Differential turnover of Nup188 controls its levels at centrosomes and role in centriole duplicationbioRxiv - Cell Biology 2019Quote: Transfection of siRNA was carried out using RNAiMax (Thermo Fisher Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... DMT1 antibody and DMT1 siRNA duplex chains were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Immunology 2019Quote: siRNAs were transfected into cells using Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2019Quote: ... or non-targeting scramble siRNA using 2 μl Lipofectamine 2000 (Invitrogen) in serum-free and antibiotic-free growth media for 6h ...
-
bioRxiv - Cell Biology 2020Quote: ... Sequences of the used Ambion Silencer Select siRNAs (Thermo Fisher Scientific) are listed in Table EV3.
-
bioRxiv - Cell Biology 2021Quote: Silencer Select Pre-designed siRNA oligomers were purchased from Life Technologies LTD ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were reverse transfected with siRNA (IDT) and Lipofectamine RNAimax (Invitrogen) so that they would be 70-80% confluent in a 10 cm plate ...
-
bioRxiv - Microbiology 2021Quote: ... siRNAs were mixed with Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) in OptiMEM medium and added to cells at a final concentration of 20 nM ...