Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Isolated B cells were stained for 20 minutes on ice with a fluorescence staining-mix containing 4’,6-Diamidin-2-phenylindol (DAPI; Thermo Fisher Scientific), anti-human CD20-Alexa Fluor 700 (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... Alexa-Fluor 594 labelled goat anti-rabbit IgG, ProLong Gold antifade reagent with DAPI (4’, 6-diamidino-2-phenylindole) (Life technologies-Invitrogen, USA), ATP Affinity kit (no ...
-
bioRxiv - Cancer Biology 2023Quote: ... sections were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min and mounted using SlowFade Diamond Antifade Mountant with DAPI (Invitrogen, Cat# S36964). Slides were imaged using a Nikon Y-FL microscope attached to a Nikon DS-Qi2 camera and images were captured using NIS elements AR software ...
-
bioRxiv - Physiology 2023Quote: ... the coverslips were washed with PBS three times before being mounted using ProLong™ Diamond Antifade Mountant with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies). Images were obtained with Olympus BX61 fluorescence microscope or Zeiss LSM800 laser confocal scanning microscope and processed using cellSens imaging software (Olympus ...
-
bioRxiv - Microbiology 2022Quote: ... After 2 washes with 1xPBS, the cell nuclei were stained with NucBlue Fixed Cell Stain ReadyProbes Reagent (4’,6-diamidino-2-phenylindole, DAPI) (Thermo Fisher Scientific) for 30 min in the dark at RT ...
-
bioRxiv - Zoology 2024Quote: ... Tissue samples were subsequently rinsed three times with DPBS again and then transferred onto microscope slides in mounting buffer containing 1:1 DPBS: glycerol and 1µg/mL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Molecular Probes, Eugene, OR) to stain cell nuclei in prepared tissues and examined under a Lumen Dynamics XCite™ 120Q Nikon fluorescence microscope (Nikon ...
-
bioRxiv - Bioengineering 2023Quote: ... The slides were thoroughly rinsed and sealed utilizing a SlowFade Gold antifade reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) and coverslips.44 The stained slides were imaged at 4x magnification with an EVOS fluorescence imaging system.
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with DAPI (4’,6-diamidino-2-phenylindole) and filamentous actin with Alexa Fluor 488-conjugated phalloidin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... cells were labeled with DAPI together with the secondary antibody (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10.000, Thermo Fisher Scientific, #D1306). The following secondary antibodies were used ...
-
bioRxiv - Cell Biology 2022Quote: ... The coverslips were then washed with 1x PBS and incubated with μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies, #D1306), followed by mounting as described above.
-
bioRxiv - Immunology 2022Quote: ... Cells were then washed with DPBS before being stained with 50 μL/well of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) (Invitrogen, cat. #D1306) diluted to 5 μM in DPBS for 15 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 250 ng/ml 4′,6-diamidino-2′-phenylindole dihydrochloride (DAPI) or 500 nM SYTOX Orange (Life Technologies, Thermo Fisher Scientific, Schwerte, Germany) were used as nucleic acid stain.
-
bioRxiv - Microbiology 2022Quote: ... in PBS prior to staining with DAPI (4=,6-diamidino-2-phenylindole) and mounted in Prolong Diamond antifade (Molecular Probes, Life Technologies). Images were captured using a Nikon Eclipse Ti confocal microscope (Nikon Instruments ...
-
bioRxiv - Microbiology 2023Quote: ... Fixed cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) for visualization of host-cell nuclei and anti-MOMP antibody conjugated to FITC (Thermo Scientific™) for visualization of Chlamydia ...
-
bioRxiv - Zoology 2023Quote: ... stained with 4′,6-diamidino-2-phenylindole (DAPI) (1:2000 dilution) and Alexa Fluor-conjugated donkey-anti-mouse (Molecular Probes, 1:1000), in PBST at room temperature for 2 hours ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were counterstained with ProLong Gold anti-fade reagent with 4’,6-diami-dino-2-phenylindole (DAPI) (Life Technologies, catalog no. P36935). Images were viewed on a Zeiss Axioskop 2 using AxioVision Rel ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were co-stained with Draq5 (Cell Signal, 4048L) or nuclei stain 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI; Thermo Fisher, D1306). Stained samples were imaged using an Olympus FV3000 Confocal Laser Scanning Microscope.
-
bioRxiv - Microbiology 2024Quote: ... The coupon was incubated in a 300 nM (100 ng/mL) solution of DAPI (4’,6-diamidino-2-phenylindole, ThermoFisher, Waltham, MA) for 3 minutes as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... slides were incubated with the OPAL 780 fluorophore-conjugated anti-DIG antibody and 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, D1306, Thermo Fisher Scientific). Slides were then mounted using Prolong Glass Antifade mounting medium and left to cure overnight in RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed in PBS-T and counterstained with 0.2 μg/ml 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Cat# 62248) diluted in 1xPBS at room temperature for 20 min ...
-
bioRxiv - Genomics 2024Quote: ... fluorescent dye DAPI (4′,6-diamidino-2-phenylindole) was added to count nuclei using a Countess II FL Automated Cell Counter (Life technologies, AMQAX1000). Bulk tagmentation was performed in a 50 μl reaction containing ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 4′,6-diamidino- 2-phenylindole (DAPI) and were transferred onto microscope slides with large-orifice 200 µL-tips (Fisher Scientific, 02707134). The following antibodies and reagents were used ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were stained with DAPI (4’,6-diamidino-2-phenylindole) by mounting the coverslips with Prolong-Gold Antifade containing DAPI (ThermoFisher Scientific, P36935). The slides were then analyzed using a Zeiss LSM 510 Meta confocal microscope ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI) and were transferred onto microscope slides with large-orifice 200 µL-tips (Fisher Scientific, 02707134). The following antibodies and reagents were used ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM Mg(OAc)2 (Invitrogen), 0.55 mM spermidine (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... and then loaded with fluorescent Ca2+ probes (3 μM of fura-2 AM or 5.69 μM of Fluo-4 AM, Life Technologies) in HBSS for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... third instar larvae were dissected in zero Ca2+ HL-3 solution at room temperature and stimulated with a HL-3 solution of 90 mM K+/2 mM Ca2+/4 μM FM4-64 (Invitrogen) for 5 min to load FM4-64 dye into the boutons ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were treated with RNAScope H2O2 for 4 min at RT and subsequently washed 2 x 3 min with UltraPure Distilled Water (Invitrogen) at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... ionomycin (1 μg/ml) and monensin (2 μg/ml) for 3-4 hours at 37°C in complete IMDM medium (Gibco). Viability staining was performed using the fixable viability dye eFluor780 ...
-
bioRxiv - Developmental Biology 2021Quote: ... were crossed for 2-3 days and then transferred to fly food made from 0.6 g of Carolina Formula 4-24 (Fisher Scientific) and 2 mL of ddH2O ...
-
bioRxiv - Genomics 2024Quote: ... and transfer plasmids were transfected at a mass ratio of 2:3:4 with Lipofectamine 3000 (Thermo Fisher Scientific L3000001) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Media was partially renewed every 3-4 days with neuronal differentiation media 2 (NDM2: 1:1 DMEM/F12:NB (Gibco), glutamax (Gibco) ...
-
bioRxiv - Biophysics 2022Quote: ... N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (NBD-PE) was purchased from ThermoFisher (Waltham, MA). Cholesterol Oxidase from Streptomyces was purchased from MP Biomedicals (Santa Ana ...
-
bioRxiv - Neuroscience 2024Quote: ... retinas were incubated with secondary antibodies at 4°C for another 2-3 days: goat anti-chicken antibody conjugated to Alexa Fluor 488 (1:1000; A11039, Invitrogen), goat anti-rabbit 555 (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... and 3 µg/mL (full dose, or diluted to 1/2, 1/4, 1/8) anti-CD28 (MA110172, Thermo Fisher), and cultured in the pre-coated plate for 3 days ...
-
bioRxiv - Microbiology 2020Quote: ... we use 1µg/ml final concentration of ethidium bromide to stain parasitized erythrocytes and 4 µl/ml Alexa Fluor 488-conjugated goat anti-human IgG (H+L) (Invitrogen, Life Technologies), based on optimal signal to noise between positive control plasma (10 Mali highly exposed individual plasma ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with Ethidium Bromide (1 mg/μL; Life Technologies). 1 μL of 2-Log DNA Ladder (200 μg/mL ...
-
bioRxiv - Cell Biology 2023Quote: 1μg/ml Ethidium bromide (Fisher Scientific, 15-585-011) was used to deplete the cells from their mtDNA content for three days ...
-
bioRxiv - Molecular Biology 2023Quote: ... and stained by ethidium bromide or SYBR Gold (Thermofisher).
-
bioRxiv - Cancer Biology 2022Quote: ... ethidium monoazide bromide (EMA, 1:500, Thermo Fisher Scientific) was added for live-dead staining to the HS and incubated 10min on ice in the dark and 10min on ice in the light ...
-
bioRxiv - Genetics 2024Quote: ... gel containing 0.5 µg/mL ethidium bromide (ThermoFisher, 15585001) and visualized with UV excitation.
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...