Labshake search
Citations for Thermo Fisher :
1051 - 1100 of 6821 citations for Recombinant Human FABP6 None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Genetics 2024Quote: ... human for rs2297550 from ThermoFisher.
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...
-
bioRxiv - Immunology 2021Quote: ... IL-2 Human Uncoated ELISA kit and IFNγ Human Uncoated ELISA kit (both from Invitrogen) and DuoSet Human IFN-gamma kit and Ancillary Reagent Kit 2 (R&D Systems ...
-
bioRxiv - Immunology 2022Quote: ... rat anti-human (16G6) and rabbit anti-human polyclonal CD49a were all purchased from ThermoFisher. For collagen measurements 10 mg of allograft tissue/sample was analyzed with a Hydroxyproline Assay Kit (Sigma ...
-
bioRxiv - Pathology 2022Quote: ... Aβ42 human ultrasensitive ELISA Kit and Tau (phospho) [pT231] human ELISA Kit from Thermo Fisher, and sAPPα and sAPPβ ELISA Kit from Mybiosource ...
-
bioRxiv - Genomics 2021Quote: ... surviving human leucocytes in thawed samples were removed using anti-human CD45 DynaBeads (ThermoFisher Scientific). The resulting parasite pellet was washed to remove soluble human DNA (hDNA) ...
-
bioRxiv - Genomics 2022Quote: Human total RNA was extracted from THP-1 human cells using TRIzol (ThermoFisher, cat# 15596026) as per manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... human kinome panel (Cat # 4475388) and human stem cell openarray panel (Cat # 4475390, ThermoFisher, USA). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... and recombinant SHH was purified with Detoxi-Gel™ Endotoxin Removing Gel (ThermoFisher) and dialyzed ...
-
bioRxiv - Plant Biology 2020Quote: All recombinant plasmids were generated by the GATEWAY cloning system (Invitrogen, http://www.invitrogen.com/). The primers used for gene amplification are listed in S3 Table ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant lentivirus was produced by transfecting HEK293T cells with Lipofectamine 2000 (Invitrogen, 11668019) or TransIT-2020 transfection reagent (Mirus ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant proteins were labeled with Alexa Fluor(tm) 647 NHS ester (Thermo Fisher) as described previously18 ...
-
bioRxiv - Biochemistry 2022Quote: ... the recombinant protein mixtures were combined with 12.5 μM diFMUP (Life Technologies, E12020), added to 384-well plates ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant adenovirus plasmids were homologously recombined with pAd/CMV/V5-DEST vectors (Invitrogen), as per manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... Recombinant lentiviruses were produced by transient transfection in HEK293FT cells (Invitrogen, CA, USA), as described earlier 18 ...
-
bioRxiv - Genomics 2019Quote: ... 4) We used RNase Inhibitor in place of RNaseOUT Recombinant Ribonuclease Inhibitor (Invitrogen) in the first-strand RT reaction ...
-
bioRxiv - Immunology 2019Quote: Chimeric VLPs or monomeric recombinant proteins were coated onto Maxisorp microtiter plates (Nunc) at 1μg/ml in PBS and incubated overnight at 4°C ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... the recombinant proteins were dialyzed using Slide-A-Lyzer™ cassettes (Thermo Fisher) into cold coupling buffer containing 100mM NaHCO3 and 500mM NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... except that a final concentration of 10 nM recombinant PKR (Life Technologies # PV4821) and 1 mM ATP was added during incubation with FLAG M2 magnetic beads ...
-
bioRxiv - Bioengineering 2021Quote: ... The cell passage was performed using recombinant cell-dissociation enzyme (TrypLE, Gibco™) to detach cells followed by neutralizing with culture medium ...
-
bioRxiv - Bioengineering 2021Quote: ... Recombinant protein expression was triggered using 0.5mM isopropyl β-D-1-thiogalactopyranoside (ThermoFisher) and incubated for 18 h in an orbital shaker at 18 °C ...