Labshake search
Citations for Thermo Fisher :
1051 - 1100 of 10000+ citations for 7 ACETOXY 4 BROMOMETHYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed on a QuantStudio 7 Flex Real-Time PCR System (ThermoFisher). Comparative CT analysis (ΔΔCT ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were incubated with 2’,7’-dichlorodihydrofluorescein diacetate (DCF-DA) (10µM; Invitrogen, Carlsbad CA) 4 hours before harvest ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dead cells were excluded either via 7-aminoactinomycin D staining 1:1000 (7AAD, Invitrogen) or Sytox AAD (1:5000 ...
-
bioRxiv - Bioengineering 2021Quote: ... The reaction was run in an Applied Biosystems QuantStudio 7 Flex System (Thermo Scientific) using the following condition ...
-
bioRxiv - Biophysics 2020Quote: COS-7 cells (ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO/BRL) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-qPCR was performed in the ViiA 7 Real-Time PCR system (Applied Biosystems), using PowerUp SYBR Green Master Mix (A25918 ...
-
bioRxiv - Immunology 2020Quote: ... MCF-7 cells were labeled with the fluorescent lipophilic dye CM-Dil (Molecular Probes) according to the manufacturer's instructions with minor modifications ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR were performed in a ViiA 7 Real-Time PCR System (Applied Biosystems) with the QuantStudio Real Time Software v1.3 ...
-
bioRxiv - Immunology 2020Quote: ... 2 mM EDTA and 1 µl of 7-AAD (Thermo Fisher, Waltham, MA, USA). 7-AAD-positive cells were quantitated by flow cytometry and analyzed with FloJo software (FloJo LLC. ...
-
bioRxiv - Genetics 2020Quote: ... and run in a QuantStudio 7 Flex Real-Time system (Applied Biosystems, catalogue 448598). Primer sequences to determine KD levels of TRAFD1 were 5’ GCTGTTAAAGAAGCATGAGGAGAC and 3’ TTGCCACATAGTTCCGTCCG ...
-
bioRxiv - Immunology 2022Quote: ... BMDMs were recovered at day 7 by scraping in PBS-EDTA 10 mM (Gibco) and centrifuged before counting and plating ...
-
bioRxiv - Developmental Biology 2022Quote: 7-day adipogenic induced cell populations were lifted with StemPro Accutase (Cat# A1110501, ThermoFisher). Lifted cells were pelleted and resuspended in 1.010 g/mL Percoll solution and loaded onto the top of the prepared Percoll Gradient ...
-
bioRxiv - Immunology 2022Quote: ... qPCR was performed in a ViiA 7 Real-Time PCR machine (Thermo Fisher Scientific) using TaqMan Universal PCR Master Mix and probes (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The 7 μm frozen sections were generated with a cryostat (Cryostar NX70, Thermo Scientific) using Kawamoto’s tape method (Kawamoto ...
-
bioRxiv - Biochemistry 2022Quote: COS-7 cells were grown in 100-mm culture plates under DMEM media (Gibco) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: 5-7 fattened adult female flies were dissected in Schneider’s Medium (ThermoFisher, catalog #21720001) supplemented with 20% fetal bovine serum and 1x antimycotic/antibiotic (VWR ...
-
bioRxiv - Bioengineering 2022Quote: ... MCF-7 and NIH/3T3 cells were maintained Dulbecco’s Modified Eagle Media (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 cells were transfected with the plasmid using Lipofectamine 2000 (Thermo Fisher Scientific). Transfection conditions are described in each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR was performed on ViiA 7 Real-Time PCR System (Thermofisher Scientific), using Powerup SYBR Green MASTER MIX (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were run on a QuantStudio™ 7 Flex Real-Time PCR System (ThermoFisher). As described previously ...
-
bioRxiv - Plant Biology 2022Quote: ... and samples were run on a ViiA 7 Real-Time PCR System (Applied Biosystems) according to manufacturer’s specifications ...
-
bioRxiv - Developmental Biology 2022Quote: cDNA synthesis for primary let-7 was done using SuperScript III Reverse Transcriptase (Invitrogen). 250ng of RNA was used for cDNA synthesis in the Eppendorf Mastercycler Pro S6325 ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) using TaqMan assays (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was conducted using ViiA™ 7 Real-time PCR System (Applied Biosystems, USA) to confirm DEcircRNAs and DElncRNAs between the treatment and control groups ...
-
bioRxiv - Microbiology 2022Quote: ... and were run in a ViiA 7 Real-Time PCR System (ThermoFisher Scientific, Canada). The cycling conditions consisted of an initial denaturation of 2 minutes at 94°C ...
-
bioRxiv - Biophysics 2022Quote: African green monkey kidney cells (COS-7) were cultured in DMEM-Glutamax (Gibco 10566016) supplemented with 10% FBS in a cell culture incubator (37°C and 5% CO2) ...
-
bioRxiv - Physiology 2022Quote: ... RT-qPCR was performed on a QuantStudio™ 7 Flex System (Applied Biosystems, UK) in a total reaction volume of 20 µL comprised of 10 µL TaqMan universal PCR mastermix-II (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... ViiA 7 Real-Time PCR System was used to perform the reaction (Applied Biosystems). The average and SDs were assessed for significance using a Student’s t test ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was performed on QuantStudio 7 Pro Real Time PCR system (Applied Biosystems). The assay consisted of 10 min denaturation at 95°C followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 7 hippocampi were placed in 5 ml of Trypsin-EDTA (Gibco, 25200-056) and incubated in the water bath at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was performed on the QuantStudio 7 Flex Real-Time PCR System (ThermoFisher #4485701) with the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... flow cytometric apoptosis quantification was performed using the CellEvent Caspase 3/7 kit (ThermoFisher) following the manufacturer’s recommendations.
-
bioRxiv - Developmental Biology 2022Quote: TaqMan synthesis for mature let-7 was done using probes synthesized by Applied Biosystems. 100ng of RNA was used for TaqMan Synthesis using High capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... Assays were performed on a QuantStudio 7 Pro real-time PCR system (Thermo Fisher). Standard curves were generated using serially diluted pcDNA3.1 plasmids containing gN ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 µg of protein sample was loaded onto 7% Tris-Acetate gels (ThermoFisher #EA03552) with ice-cold 1X Tris-glycine buffer and run at 125V and 4°C for approximately 1 hr ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 8.0) with 7 kU Pierce Universal Nuclease for Cell Lysis (Thermo Fisher # 88702) and gentle end-over-end rotation for 15 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... qPCR was performed using an ABI QuantStudio 7 Flex (Thermo Fisher, Waltham, MA, USA) with PowerUp SYBR Green Master Mix from Thermo Fisher (Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... Gates were validated by 7-AAD Viability Staining Solution (cat # 00-6993-50, Invitrogen) to identify live and dead cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 6µM CellEvent Caspase-3/7 Green Detection Reagent (Thermofisher, #C10423, green fluorescence). Cancer cell lines (IGR-Heu and IGR-Pub ...
-
bioRxiv - Developmental Biology 2023Quote: ... Monocyte differentiation was induced from HSC for 5-7 days in RPMI (Gibco, #11875093), 10% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... QPCR reactions were performed using QuantStudio 7 Flex Real-Time PCR Systems (Applied Biosystems) and data was collected using the QuantStudio Real-Time PCR Software v1.3 ...
-
bioRxiv - Immunology 2023Quote: ... qPCR was performed on a QuantStudio 7 Flex real-time PCR system (Applied Biosystems). mRNA expression data were normalised to HPRT and analysed by the comparative CT method ...
-
bioRxiv - Cell Biology 2023Quote: ... The QuantStudio 7 Flex Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) was used to measure gene expression levels ...
-
bioRxiv - Cell Biology 2023Quote: ... and cut into 7 µm thin sections with a cryostat (Thermo Scientific, Cryostar NX70). Sections were then heated to 37°C for 8 minutes ...
-
bioRxiv - Biochemistry 2023Quote: Thermal shift experiments were carried out using a QuantStudioTM 7 Flex system (Applied Biosystems) in a MicroAmp Optical 384-well plate (Applied Biosystems 4309849)57 ...
-
bioRxiv - Neuroscience 2023Quote: ... These assays were run in QuantStudio 7 Flex Real-Time PCR Systems (ThermoFisher Scientific). The Ct value was defined as the number of cycles required for the fluorescence to exceed the detection threshold ...
-
bioRxiv - Immunology 2023Quote: ... Organoids (>passage 7) were passaged via single cell dissociation using 1x TrypLE Express (Gibco) and resuspended in Advanced DMEM/F12 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... media was buffered at a pH of 7 using 126 mM Na2HPO4 (Acros Organics) and 18 mM citric acid (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2023Quote: ... buffer exchanged into PBS using 7 kDa MWCO desalt spin columns (Thermo Scientific, #89882) and then measured for absorbance at 280 nm to determine its concentration ...
-
bioRxiv - Microbiology 2023Quote: ... and either the QuantStudio™ 5 or QuantStudio™ Flex 7 analyser (Applied Biosystems). For analysis on viral gene copy numbers ...