Labshake search
Citations for Thermo Fisher :
1051 - 1100 of 10000+ citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... each coverslip was incubated in 3 μl fura-2 acetoxymethyl (AM) ester (Invitrogen) in 1X HBSS containing 5 mg/ml BSA (Sigma- Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... To this mixture we added glycerol 2-phosphate (3 M, Thermo Fisher Scientific) and (GT)15-SWCNTs (3.75 mg/L ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-3 µg of total RNA were treated with DNase I (Thermo fisher), and half was reverse transcribed using the SuperScript™ IV First-Strand Synthesis System (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: Cells were loaded with 2 µg/ml Fluo-3 AM (Thermo Fisher Scientific) and 5 µg/ml Fura Red AM (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... The final products were visualized via gel electrophoresis using 2-3% Agarose (Invitrogen) gels ...
-
bioRxiv - Microbiology 2024Quote: ... which was then transferred to 2-3 mL TRIzol Reagent (Invitrogen, Waltham, MA) to form a slurry and finally thawed ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae at 5 dpf were incubated in 3 µM FM 1-43 (Thermofisher, T3163) in E3 media for 35 s ...
-
bioRxiv - Biochemistry 2024Quote: ... dsRNA complex (2:1 molar ratio) were cross-linked with 30 μg 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Fisher Scientific, EDC: protein = 3:1 w/w) in the presence of 66 μg N-hydroxysulphosuccinimide (NHS ...
-
bioRxiv - Biophysics 2021Quote: ... Cell nucleus were stained with DAPI (4’,6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were stained with 4’,6diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) at 37 °C for 5 min in PBTX solution ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... All preparations were stained with 4’,6’-diamidino-2-phenylindole (DAPI, Invitrogen) for 10 minutes to label nuclei and mounted with Fluoroshield medium (Sigma) ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were counterstained with 4’,6’-diamidino-2-phenyliondole (DAPI; Invitrogen, D1306). Coverslips were mounted with ProLong™ Gold Antifade (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... 30 min incubation with 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) (1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were briefly stained with 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher) to reveal the nuclei ...
-
bioRxiv - Genomics 2020Quote: ... followed by nuclear staining with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen). Both bright field and nuclear staining images were separately taken using a Keyence BZ-X700 All-in-One microscope.
-
bioRxiv - Biochemistry 2020Quote: ... USA) and 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4 °C for 2 h and eluted by TEV protease (Invitrogen) cleavage at 4 °C overnight ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Bioengineering 2021Quote: ... Nuclei were stained with 4’,6-Diamidin-2-phenylindol (DAPI, Invitrogen, #D1306) 1:10,000 in 0.01 M PBS.
-
bioRxiv - Neuroscience 2021Quote: ... Tissue was then flash frozen with 2-methylbutane (O3551-4, Fisher Scientific) and stored at −75°C until sectioning.
-
bioRxiv - Neuroscience 2021Quote: ... at 1:200 and (4’,6-diamidino-2-phenylindole) DAPI (Fisher Scientific) at 1:10,000.
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were afterwards counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen). The primary antibodies used were nephrin (Progen ...
-
bioRxiv - Microbiology 2020Quote: ... Cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) to calculate the CC50 values ...
-
bioRxiv - Neuroscience 2020Quote: ... and 4’,6’-diamidino-2-phenylindole dihydrochloride (1 µg/ml, Life Technologies) for 2 hr ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were first loaded with Fluo-4-AM (2 μM, ThermoFisher, F14201) in Neurobasal A+ media for 30 min ...
-
bioRxiv - Physiology 2020Quote: ... Invitrogen™ DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (ThermoFisher Scientific #D1306) and used at the concentration of 1.0 ug/mL in wash solution.
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D3571). Primary antibodies used for immunoblotting include reovirus-specific polyclonal rabbit antiserum ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole; D1306, Thermo Fisher Scientific, Reinach, Switzerland) was then used for nuclear staining ...
-
bioRxiv - Neuroscience 2022Quote: ... Then one drop of DAPI (4′, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was added to the suspension and 25 nuclei were sorted by Aria II (BD ...
-
bioRxiv - Immunology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) or Live/dead fixable blue (ThermoFisher) was used to exclude dead cells.
-
bioRxiv - Neuroscience 2022Quote: ... On day 4 cells were passaged 1:2 with Stempro Accutase (Invitrogen) for 5 minutes at 37C and replated on hESC qualified Matrigel® ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 4′,6-diamidine-2-phenylindole dihydrochloride (DAPI) were purchased from Thermo Fisher Scientific (CA ...
-
bioRxiv - Cell Biology 2022Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10,000, Invitrogen). For staining of lipid droplets ...
-
bioRxiv - Microbiology 2020Quote: ... Cell nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole, Invitrogen) in PBS for 20 min at RT ...