Labshake search
Citations for Thermo Fisher :
1001 - 1050 of 3690 citations for CdSeTe ZnS Quantum Dots NIR region Water solvent 760nm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... Coding regions were cloned in frame with the α-mating factor in the pPinkα-HC vector (Invitrogen), enabling protein secretion ...
-
bioRxiv - Genetics 2021Quote: Quantitative PCR for promoter regions of interest was performed with Absolute Blue SYBR Green (Thermo Scientific AB4166B) on the CFX96 Real Time System Thermocyclers (Biorad ...
-
bioRxiv - Genomics 2021Quote: ... Genomic regions of interest were identified by real-time PCR (qPCR) using SYBR Green Master Mix (Invitrogen) and specific oligonucleotides in a Roche 480 Light Cycler machine ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cells in different regions were separated and adhered to CapSure HS LCM Caps (Thermo Fisher LCM0215). Genomic DNA was isolated from these different caps using PicoPure DNA Extraction kit (Thermo Fisher KIT0103) ...
-
bioRxiv - Immunology 2020Quote: ... The JH4 intron region was PCR amplified using a high-fidelity Platinum SuperFi II DNA polymerase (Invitrogen) with primers listed in Extended data Table 1 ...
-
bioRxiv - Immunology 2020Quote: ... This was followed by PCR amplification of the desired region using DreamTaq Polymerase (Thermo Fisher Scientific EP0705). Amplified DNA was PCR-purified using QIAquick PCR Purification Kit (Qiagen 28106 ...
-
bioRxiv - Immunology 2021Quote: ... fragments containing a biotinylated C region were captured by M270 beads which were crosslinked to streptavidin (Invitrogen), with a dissociation ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: For chrd WISH experiments amplified region was cloned into TOPO II dual promoter vector (Thermo scientific, USA). To generate antisense probe ...
-
bioRxiv - Microbiology 2020Quote: ... approximately 2 kb flanking regions on either side of cdsA were amplified using Phusion polymerase (Thermo Fisher). PCR products were digested with restriction enzyme XmaI (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... the capsid region was amplified by PCR from pCVB3-XhoI-P1-Kpn2I with Phusion polymerase (Thermo Scientific) and primers HiFi-F (CTTTGTTGGGTTTATACCACTTAGCTCGAGAGAGG ...
-
bioRxiv - Immunology 2020Quote: ... neck and CRD regions of human SP-D was transformed into Escherichia coli BL21 (λDE3) pLysS (Invitrogen). The transformed colonies (selected by ampicillin resistance ...
-
bioRxiv - Immunology 2021Quote: ... The constant regions of heavy (HC) and light chain (LC) were cloned separately into pcDNA3.4 (ThermoFisher Scientific). Subsequently ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue blocks containing the frontal cortex and the hippocampus region were cut using a microtome (ThermoFisher HM1030) at 5µm and mounted on a charged slide ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding regions were transferred into Pvha-6-GFP or Pvha-6-RFP vectors by LR reaction (Invitrogen). Constructs were bombarded into unc-119(ed3 ...
-
bioRxiv - Microbiology 2023Quote: ... The ybeX coding region was removed via restriction enzyme cleavage of XmaJI and SfiI (Thermo Scientific™). The sticky ends were filled using Klenow fragment (Thermo Scientific™ ...
-
bioRxiv - Plant Biology 2023Quote: ... The target regions were amplified on the GeneAmp PCR System 9700 (Applied Biosystems, Foster City, California, U.S.A.) and Mastercycler nexus (Eppendorf ...
-
bioRxiv - Neuroscience 2023Quote: ... DRGs from bilateral lumbar regions were removed into DMEM/F12 (Gibco; Thermo Fisher Scientific, Waltham, MA, USA) medium in each animal ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing of PCR amplicons encompassing the edited regions that were subcloned into the TOPO-TA vector (Invitrogen) revealed a subset with in-frame deletions in mouse Scn9a ...
-
bioRxiv - Microbiology 2023Quote: ... The V4 region of the bacterial 16S rRNA was amplified by PCR (Veriti Thermal Cycler, ThermoFisher Scientific) using 20 ng of DNA ...
-
bioRxiv - Plant Biology 2023Quote: Full-length coding regions of TOB1 and TOB2 without stop codons were cloned into pENTR (Thermo Fisher) and transferred to pPUG2 for overexpression of C-terminal GFP fusion proteins43 ...
-
bioRxiv - Plant Biology 2024Quote: ... the STZ coding region was cloned into pENTR™ /D-TOPO™ vector (Thermo Fisher Scientific, USA). The pDONR P4-P1r vector containing p35S::XVE>>pLexA was obtained from Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... Rubrum CbbM coding region in a His-bdSUMO plasmid acquired from Addgene65 using OneShotTM Top10 cells (Invitrogen). The constructs were expressed in OneShotTMBL21-AITM (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... This region was excised using AflII and BamHI and blunted with Klenow fragment (Fisher Scientific, Schwerte, Germany). The fragment was then cloned into the vector pMP44 (42 ...
-
bioRxiv - Microbiology 2024Quote: ... Validated siRNAs targeting the three regions of the upregulated genes were ordered from Silencer Select (Applied Biosystems). Control shRNAs and shRNAs targeting CCNL1 were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... Primers were used to amplify the region of interest using a SimpliAmp Thermal Cycler (Thermo Fisher Scientific) and the PCR product was cleaned up using Genomic DNA Clean & Concentrator (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the region of interest was amplified by PCR using Phusion High Fidelity DNA Polymerase (Thermo Fisher). Oligos are listed in Supplementary Table S2 ...
-
bioRxiv - Cell Biology 2024Quote: ... and position (1235-1252 bp) 5’ GcCGcATtCTcGAgGTtG 3’ (modified region corresponding to siRNA from Thermo Fisher s38908). The following restriction sites were modified ...
-
bioRxiv - Cell Biology 2024Quote: ... and position (2164-2187 bp) 5’ gAgGAcGAgGCcTGGTAtCAaAaa 3’ (modified region corresponding to siRNA from Thermo Fisher s228498). The following restriction sites were modified ...
-
bioRxiv - Cell Biology 2024Quote: ... and position (607-627 bp) 5’-cAaGAaTTcCGaGAgACtAAc- 3’ (modified region corresponding to siRNA from Thermo Fisher s34150). The following restriction site was modified ...
-
bioRxiv - Neuroscience 2022Quote: ... Accela UPLC pump coupled to a Quantum Access triple quadrupole mass spectrometer equipped with a heated electrospray (HESI) probe (Thermo Scientific, San Jose, CA, USA). The capillary and spray temperatures were both set to 300°C and the electrospray capillary voltage to 4 kV ...
-
bioRxiv - Biochemistry 2023Quote: ... Data acquisition was performed using an Ultimate 3000 HPLC system interfaced with a TSQ Quantum Access MAX triple quadrupole Mass Spectrometry (Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... A volume of 20 μL Sera-Mag A beads were combined with 20 μL of Sera-Mag B beads and washed with 160 μL of water by placing the water-bead mixture on a magnetic rack for PCR tubes (DynaMag PCR Magnet, Thermo Scientific, Cat: 492025), and beads were settled for 2 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... The mixed SARM/PLGA solution was added to an aqueous phase (30 mL; 1% w/v polyvinyl alcohol in Nanopure water; Barnstead Thermolyne Nanopure water purification system, Thermo Fisher,Waltham, MA) and the mixture was immediately emulsified using either a Talboys Model 101 overhead mixer at speed 2833 rpm for 4 minutes (formulation 1 ...
-
bioRxiv - Immunology 2022Quote: ... equipped with two Waters pre-columns and a Waters nano m/z analytical column (75 μm × 250 mm, 3 μm, 100 Å, Thermo Fisher Scientific) (Gronemeyer et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... The custom probes were synthesized to an amount of 5 nmol per DNA oligo pool byIntegrated DNA Technologies (https://www.idtdna.com) and re- suspended to 50 µM with Nuclease Free water (Invitrogen UltraPureTM Distilled Water, 10977-015). Targeting 14 genes of interest ...
-
bioRxiv - Neuroscience 2022Quote: ... Each piece of nylon was extracted in 1 mL of extraction solvent in a 5 mL Eppendorf tube (Fisher Scientific Catalog #: 14-282-301). 5 mL Eppendorf tubes containing extraction solvent and nylon were kept overnight at -20°C ...
-
bioRxiv - Bioengineering 2021Quote: ... A 1 μL sample of each taxadiene containing organic solvent extract was injected into a TRACE™ 1300 Gas Chromatograph (Thermo Fisher Scientific, UK) coupled to an ISQ LT single quadrupole mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... and 95% ACN with 0.1% formic acid (solvent B)] at a flow rate of 300 nl/min and analyzed on LTQ Orbitrap Velos (Thermo Scientific, Waltham, MA, USA). 1.7kV was applied for ionization ...
-
bioRxiv - Biochemistry 2022Quote: All solvents and additives used for lipid extraction were of the highest grade available (either LCMS or HPLC grade; ThermoFisher Scientific, Melbourne, VIC, Australia). Bulk cell extracts were prepared from adherent cells grown in 6 well plates ...
-
bioRxiv - Biochemistry 2020Quote: ... were dissolved in 100 ul DMSO solvent and optical density was measured spectrophotometrically by taking absorbance at 570 nm using Varioskan™ LUX multimode microplate reader (Thermo Fisher Scientific™). The absorbance of untreated cells was taken as 100%.
-
bioRxiv - Microbiology 2024Quote: ... Phospholipids stored in chloroform were combined at the indicated ratios (for a total of 1 mg) and the solvent was evaporated using a SpeedVac Concentrator (Thermo Fisher Scientific, Atlanta, GA). Dried lipid films were rehydrated for 1 h at room temperature in 0.5 ml of PBS and large unilamellar liposomes were generated by extrusion (>11 passes ...
-
bioRxiv - Neuroscience 2021Quote: ... Body temperature was maintained at 37 ± 0.5°C using a circulating water blanket connected to a temperature adjustable water bath (Haake S13, Thermo Fisher Scientific, Waltham, MA, USA). Ventilation tidal volume was adjusted to keep the heart rate at 300 ± 50 beats per minute ...
-
bioRxiv - Cell Biology 2022Quote: Canola oil was mixed with highlighter ink (in trace amounts) and suspended in water or water with 3% (w/v) Triton X-100 Detergent Solution (85111, ThermoFisher Scientific, Waltham, MA, USA). The oil drop was then visualized in blacklight as it was deformed by a thin steel wire 0.5 mm in diameter.
-
bioRxiv - Neuroscience 2021Quote: ... and on a UPLC Waters Acquity (Waters Corp, Saint-Quentin-en-Yvelines, France) coupled to Q-Exactive mass spectrometer (Thermo Scientific, San Jose, CA). Experimental settings for global approach by LC-HRMS were carried out as detailed in the paper of Garali et al [19].
-
bioRxiv - Neuroscience 2021Quote: ... The body temperature was maintained at 37 ± 0.5°C using a circulating water blanket connected to a temperature adjustable water bath (Haake S13, Thermo Fisher Scientific, Waltham, MA, USA). The tidal volume of mechanical ventilation was adjusted to keep the heart rate at 300 ± 50 beats per minute ...
-
bioRxiv - Molecular Biology 2024Quote: ... were analyzed using reversed-phase LC-ESI-MS/MS using a Waters Aquity UPLC H class system (Waters Corp., Milford, MA) coupled with a Velos Pro Orbitrap mass spectrometer (Thermo Scientific, San Jose, CA). Prior to analysis ...
-
bioRxiv - Cancer Biology 2024Quote: ... Approximately 1µg of each sample was injected onto a Waters M-Class nanoAcquity HPLC system (Waters, Milford, Massachusetts) coupled to a Q Exactive Plus Orbitrap (Thermo Fisher Scientific, Waltham, Massachusetts) operating in positive mode ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were processed under protein precipitation methods and analyzed by LC-MS/MS for quantitation in a TSQ Quantum Access (Thermo Fisher Scientific, San Jose, CA, USA). The lower limit of quantification was 5 ng/ml.
-
bioRxiv - Cell Biology 2020Quote: ... RNA was eluted using nuclease-free water (Thermo Fisher Scientific) and the concentration measured with Qubit® RNA Assay Kit in Qubit® 3.0 Fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Microdissected tissue was collected into LC-grade water (Fisher Scientific), a tissue extraction/lysis buffer ...