Labshake search
Citations for Thermo Fisher :
1001 - 1050 of 3080 citations for CEPT1 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... After transfection of 20 pmol siRNA using Lipofectamine RNAiMAX (Invitrogen), cells were cultured in normal medium for 24 hrs and subsequently incubated in serum starved medium.
-
bioRxiv - Cancer Biology 2022Quote: Transient siRNA transfections were carried out with Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: siRNA transfection was performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: siSLX4-4 (CAGATCTCAGAAATCTTCATCCAAA) is a Stealth siRNA synthetized from Invitrogen.
-
bioRxiv - Cell Biology 2021Quote: ... For simultaneous transfection of siRNA and plasmid DNA Lipofectamin2000 (Invitrogen) transfection reagent was applied according to manufacturer protocol ...
-
bioRxiv - Microbiology 2020Quote: ... IFITM2 or IFITM3 specific siRNA using Lipofectamine RNAiMAX (Thermo Fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Reverse transfection of siRNA was performed using Lipofectamine RNAiMAX (Invitrogen) as previously described [88] ...
-
bioRxiv - Cancer Biology 2020Quote: Predesigned siRNAs for human FXR1 were purchased from Thermo Fisher Scientific Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... and the Silencer® Select pre-designed siRNA (Life Technologies) for human RIPK3 (GGCAAGUCUGGAUAACGAAtt ...
-
bioRxiv - Microbiology 2022Quote: ... or HPRT1 siRNA #2 (s6888) diluted in OptiMEM (Gibco, 31985070). RNA was harvested from cells 48 hpt knockdown validation by RT-qPCR ...
-
bioRxiv - Cell Biology 2022Quote: siRNA gene silencing was performed using RNAiMAX (Thermo Fisher Scientific) and customized targeted siRNA sequence as per the manufacturer’s instruction and as previously described (Delos Santos et al. ...
-
bioRxiv - Biophysics 2019Quote: ... cells were treated with sequence-specific predesigned siRNA (Ambion, Singapore). 2 nM siRNA was electroporated in approximately 106 cells ...
-
bioRxiv - Cell Biology 2019Quote: Cell transfection with siRNAs was performed using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: All siRNAs were transfected at 66nM using Lipofectamine RNAiMAX (Invitrogen). For survival assay ...
-
bioRxiv - Cell Biology 2019Quote: All siRNA transfections were performed using Lipofectamine RNAi MAX (Invitrogen) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with 5nM siRNA via Lipofectamine RNAiMAX (ThermoFisher). 72 h after transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... with addition of 20 nM DNMT3b siRNA (ThermoFisher, cat #161533) according to manufacture protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were transfected using Lipofectamine-RNAiMAX (13778100, Thermo Fisher Scientific) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... mGAS5 siRNA (n251731) was purchased from Life Technologies (Gaithersburg, MD). Smad3 inhibitor SIS3 was purchased from Sigma-Aldrich (St ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection of siRNAs was performed using Oligofectamin (Invitrogen Life Technologies) following the user guide ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection of siRNAs was performed using Oligofectamin (Invitrogen Life Technologies) following the user guide ...
-
bioRxiv - Pathology 2021Quote: ... Knockdown experiments were performed using Silencer Select siRNA from Ambion STAT3 (4392420 ...
-
bioRxiv - Neuroscience 2019Quote: ... LRRK2 siRNA #2 was purchased from ThermoFisher (ID: 263837; 38). All LRRK2 knockdowns after the initial validation used both LRRK2 siRNA #1 and #2 in combination ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected with the siRNAs using Lipofectamin RNAiMAX (Thermofisher) according to manufacturer’s instructions for 48 h (caspase-8 ...
-
bioRxiv - Cell Biology 2019Quote: All siRNAs used in this study were obtained from Ambion Thermo Fisher Scientific as Silencer Select reagents ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... siRNAs in OptiMem I Reduced Serum Media (31985, Thermo Fisher) were mixed with an equal volume of OptiMem containing Lipofectamine RNAiMax (13778 ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA were transfected using Lipofectamine 2000 (ThermoFisher Scientifics, 11668-019) at the final concentration of 2 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... The siRNA against mouse Nup50 (156930) was purchased from Ambion Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA was delivered to cells using Lipofectamine RNAiMAX (ThermoFisher, 13778150). Plasmid transfections were performed using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... we used 20μM siRNA duplexes using Lipofectamine RNAi max (Invitrogen) according to manufacturer’s guideline ...
-
bioRxiv - Cell Biology 2021Quote: ... Silencer™ Pre-Designed siRNAs targeting EEF1A1 (Ambion, ID: 2991), EEF1A2 (Ambion ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA reverse-transfections were carried out with Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNAs (100 nmol/l) were mixed with RNAiMAX (Invitrogen) in 100 μL of serum-free DMEM and incubated for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... MDCK cells were transfected with siRNAs using Lipofectamine RNAiMAX (Invitrogen). The MDCK-transformant clones expressing nonsilencing shRNA or shRNA for ASPP2 have been described previously (Cong et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were reverse transfected with 10nM siRNA (Ambion/Thermo Fisher), using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were reverse transfected with 10nM siRNA (Ambion/Thermo Fisher), using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... The siRNA transfection was performed with Lipofectamine RNAiMAX (Invitrogen, 13778150) according to the manufacture’s protocols.
-
bioRxiv - Genetics 2021Quote: ... Silencer Select siRNA against CETP (Ambion cat 4392420 ID 2933) or Negative Control siRNA (Ambion cat #4390844 ...
-
bioRxiv - Microbiology 2021Quote: ... siRNA experiments were done with Lipofectamine® RNAiMAX Reagent (Invitrogen) according the protocol of the manufacturers ...
-
bioRxiv - Molecular Biology 2021Quote: Silencer Select siRNAs (s4829, s4830, and s4831; Life Technologies Inc.) or ON-TARGETplus Smartpool siRNAs (L-040772-00-0010 ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA-mediated gene silencing was performed by lipofectamine RNAiMAX (Invitrogen) mediated transfection following the instruction from the manufacture ...
-
bioRxiv - Cell Biology 2021Quote: ... we applied 180 nmol siRNA and 3% Lipofectamine RNAimax (Invitrogen) instead ...
-
bioRxiv - Cell Biology 2021Quote: Small interfering RNAs (siRNAs) were delivered with lipofectamine RNAiMax (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were transfected with siRNA caveolin 1 (Thermofisher, Waltham, MA) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... and murine Asns-targeting siRNA (s7704 and s7705, ThermoFisher Scientific) or negative control siRNA (siNC ...
-
bioRxiv - Cancer Biology 2022Quote: ... with a negative siRNA (Silencer Select #1, Thermo Fisher Scientific) as a nonspecific control using the procedure previously described (Minami et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with siRNAs using lipofectamine RNAiMAX (Life Technologies) transfection reagent according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs were transiently transfected into cells using Lipofectamine RNAiMAX (Invitrogen), according to the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2022Quote: ... the mixture of TEAD1 siRNA (Thermo Fisher, Silencer Select s13962) or scrambled negative control siRNA was used at a final concentration of 10 nM (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... a mixture of Lats1 siRNA (Thermo Fisher, Silencer Select s17393) and Lats2 siRNA (Thermo Fisher ...