Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for ssc mir 369 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Primer/probe sets were obtained from ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... The following Taqman Primer/Probe sets (ThermoFisher) were used in this study ...
-
bioRxiv - Molecular Biology 2020Quote: ... with Taqman assay primer sets (Applied Biosystems) as per the manufacturers specifications ...
-
bioRxiv - Microbiology 2020Quote: ... using TaqMan primer/probe sets (Thermo Fisher) against ZIKV48 (Assay ID APH6AE9 ...
-
bioRxiv - Immunology 2021Quote: ... Taqman primer/probe sets (Applied Biosystems, CA) were used for real-time gene expression analysis using ABI Prism 7500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primer-probe sets were purchased from ThermoFisher Scientific (Applied Biosystems Gene Expression Assays ...
-
bioRxiv - Microbiology 2022Quote: ... and TaqMan primer-probe sets (ThermoFisher Scientific) listed in Table 3 on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Immunology 2024Quote: ... dNTP set and oligo(dT) primer (Invitrogen) per manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2023Quote: ... Primer/probe sets were obtained from ThermoFisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... RT specific primers 5X (ThermoFisher) were multiplexed in a primer pool containing 1% of each diluted in an adequate volume of Tris-EDTA 1X ...
-
bioRxiv - Neuroscience 2020Quote: ... and stored overnight at RT in 5x SSC buffer (Thermo Fisher Scientific). The next day ...
-
bioRxiv - Developmental Biology 2019Quote: ... and gene specific primer sets on a StepOne Plus PCR Detection System (Applied Biosystems Life Technologies). Each qPCR reaction was carried out in triplicate ...
-
bioRxiv - Developmental Biology 2019Quote: ... and gene specific primer sets on a StepOne Plus PCR Detection System (Applied Biosystems Life Technologies). Each qPCR reaction was carried out in triplicate ...
-
bioRxiv - Molecular Biology 2021Quote: ... β-Actin DNA was PCR amplified using a premade TaqMan probe/primer set (ThermoFisher, Cat #431182), while β-Actin cDNA in RNA analyses was quantified using a separate Taqman probe/primer set that amplifies across a splice junction (FP ...
-
bioRxiv - Microbiology 2023Quote: ... antarcticus cells was assessed by standard PCR with both sets of primers using DreamTaq polymerase (ThermoFisher) for 35 cycles at 55 °C annealing temperature ...
-
bioRxiv - Developmental Biology 2020Quote: All primers were Assay-on-Demand primer/probe sets from Thermo Fisher Scientific (Richlands ...
-
bioRxiv - Neuroscience 2019Quote: ... To perform PCR different primer sets were used (Tab.1) and PCR was executed with Phire Hot Start II DNA Polymerase (ThermoFisher).
-
bioRxiv - Neuroscience 2022Quote: ... We used reverse-transcriptase-specific primers for mmu-miR-134 (Applied Biosystems miRNA assay ID 001186 ...
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... Each gene segment was synthesized by gene specific primers (primers available upon request) using SuperScript III One-Step RT-PCR System (Invitrogen).
-
bioRxiv - Molecular Biology 2021Quote: ... 20X Taqman primers/probe set (Thermo Fisher Scientific), 1µl of diluted cDNA and RNAse-free H2O ...
-
bioRxiv - Neuroscience 2021Quote: ... The following primer/probe sets were used (ThermoFisher): Mouse ActB ...
-
bioRxiv - Immunology 2022Quote: ... Optimized primer/probes sets were purchased from ThermoFisher Scientific with the following assay IDs ...
-
bioRxiv - Immunology 2021Quote: ... using commercial Taqman primer/probe sets (Life Technologies). Probes for mouse genes included ...
-
bioRxiv - Neuroscience 2023Quote: ... 20X TaqMan primers/probe set (Thermo Fisher Scientific), 1 µL of diluted cDNA and RNAse-free H2O ...
-
bioRxiv - Microbiology 2020Quote: ... real-time PCR was performed using commercially validated TaqMan-based primer-probe sets (Supplementary Table 1) and TaqMan Universal PCR Mix (Life Technologies). Results were then normalized as described above.
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was conducted using TaqMan Assay-on-Demand primer sets (Applied Biosystems by Thermo Fisher Scientific) or Power SYBR Green PCR Master Mix (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was conducted using TaqMan Assay-on-Demand primer sets (Applied Biosystems by Thermo Fisher Scientific) or Power SYBR Green PCR Master Mix (Merck) ...
-
bioRxiv - Neuroscience 2023Quote: The PCR products using the primer sets were subcloned into the pCR Blunt II TOPO vector for each (Zero Blunt TOPO PCR Cloning Kit, Thermo Fisher) and sequenced using M13-Foward and M13-Reverse primers ...
-
bioRxiv - Cell Biology 2019Quote: ... with gene-specific primer sets using the Platinum Quantitative PCR SuperMix-UDG with ROX (11743-100, Invitrogen) under the following reaction conditions ...
-
bioRxiv - Microbiology 2021Quote: ... 5μl were used for quantitative PCR with primer/probe sets for human GAPDH (Applied Biosystems Cat# Hs99999905_m1) and HIV-1 genomic RNA (primers GGCCAGGGAATTTTCTTCAGA / TTGTCTCTTCCCCAAACCTGA (forward/reverse ...
-
bioRxiv - Physiology 2019Quote: ... TaqMan PCR was performed using commercially available primer-probe sets for GLP-1R and GAPDH (Applied Biosystems) and analysed on an ABI Prism (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Technical triplicates were prepared for each primer set using SYBR Green PCR Master Mix (Applied Biosystems 4309155). The following primers were used:
-
bioRxiv - Cell Biology 2022Quote: ... Subsequently RT-PCR of the purified RNA was performed using OligodT20 Primer (18418020,Thermo Fisher) and SuperScript III Reverse Transcriptase (18080044 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... IAV infection was assessed using rRT-PCR targeting the M segment: National Veterinary Services Laboratory PCR primer protocol (no. SOP-BPA-9034.04) with SuperScript One-Step RT-PCR (Invitrogen). Samples were defined as IAV positive using a Ct cutoff of <45.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... q-RT-PCR primers for reference genes and target genes were designed using Primer Express software (Applied Biosystems, Foster City, California). For all investigated tissues and conditions ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative PCR reactions with 25 ng cDNA and 0.4 μM primers were set up using the DyNAmo Flash SYBR Green RT-qPCR kit (F415L, Thermo Scientific, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RNA was amplified using the TaqPath 1-Step RT-qPCR Master Mix with gene-specific primer/probe sets purchased from Life Technologies. RNA levels of specific genes were measured by quantitative PCR using QuantStudio 7 (Thermo Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... TaqMan Fast Universal PCR Mastermix and TaqMan miRNA Assays primers were used to detect miR-23a-3p and miR-10b-5p (QuantStudio 12K Flex, Thermo Fisher Scientific). All reactions were run in triplicate and results were expressed as 2−ΔΔCt ...
-
bioRxiv - Cancer Biology 2021Quote: ... as previously described (48) using the following primers: hsa-miR-21 (Thermofisher #0003970) and Z30 (Thermofisher #001092) ...
-
bioRxiv - Microbiology 2021Quote: ... we verified that every single “infected” midgut contained developing Plasmodium parasites by detecting the ookinete mRNA marker encoding Pvs25 or Pfs25 using primer sets reported by (Wampfler et al. 2013) and q-PCR (Power SYBR™ Green PCR Master Mix amplification - Life Technologies).
-
bioRxiv - Molecular Biology 2019Quote: ... 1μL of primer/probe set (Applied Biosystems, Thermo Fisher) and 8μL H2O ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1μL of primer/probe set (Applied Biosystems, Thermo Fisher) and 8μL H2O ...
-
bioRxiv - Microbiology 2020Quote: ... and a random primer set (Invitrogen, cat. no.: 48190011), followed by qPCR using HIV-1 primers and probes (specific for transcription of the first nucleosome nuc1a or gag/u1a ...
-
bioRxiv - Immunology 2021Quote: ... The following Taqman Primer/Probe sets (Thermo Fisher Scientific) were used in this study ...
-
bioRxiv - Neuroscience 2023Quote: ... and primer and probe sets purchased from Applied BioSystems. Relative gene expression was determined using the ΔΔCt method with cyclophilin as an internal control (88).
-
bioRxiv - Immunology 2022Quote: ... Isoforms of XBP1 were detected using non-quantitative RT-PCR using the primers listed in table S1 and Phusion High-Fidelity PCR Master Mix (ThermoFisher) with the following cycling conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR was performed on a BioRad CFX384 thermocycler using pre-validated Taqman primers (Applied Biosystems) for BMAL1 (ARNTL) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with microRNA specific RT primer (Applied Biosystems). A TaqMan® microRNA assay was performed using AB StepOneTM real-time PCR system to quantify relative miRNAs expression in these samples ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR was performed through StepOne Plus RT-PCR (Applied Biosystems) using Power SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... RT-PCR was performed on a StepOnePlus RT-PCR system (Invitrogen) with fast SYBR Green Master Mix (Applied Biosystems ...