Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Nonanoic acid reaction products with diethanolamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... The reaction product was then transformed into Library Efficiency™ DH5α Competent Cells (Thermo Scientific) and plated on appropriate antibiotic plates ...
-
bioRxiv - Genetics 2023Quote: ... Polymerase chain reaction products were amplified using Phusion HS II DNA polymerase (F549; Thermo Fisher). Gibson Assembly was conducted using Gibson Assembly Master Mix (E2611 ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction products were loaded onto a 12% SDS-PAGE or a 12% NuPAGE (Invitrogen) using 4x loading dye (1 M TRIS ...
-
bioRxiv - Molecular Biology 2020Quote: ... A one-tube Gateway reaction was performed using pDonr221 and pRosa26 Dest.65 The reaction product was used to transform competent STBL3 cells (Life Technologies, # C7373-03) that were plated on Ampicillin and Kanamycin to select for destination and entry clones ...
-
bioRxiv - Biochemistry 2023Quote: All reactions were quenched by adding 1 μL of formic acid (Thermo Scientific, 85178) and diluted to a volume of 200 μL prior to desalting ...
-
bioRxiv - Bioengineering 2022Quote: ... Folding reaction products were subjected to agarose gel electrophoresis[15] in a 2% agarose (Life Technologies) gel (0.5x TBE ...
-
bioRxiv - Biochemistry 2021Quote: ... Reaction products were separated on a Novex Bis-Tris 4–12% SDS−PAGE gel (Life Technologies). The gel band corresponding to the cross-linked complex was excised and digested with trypsin (Thermo Scientific Pierce ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl of cDNA reaction product was mixed with PowerUp SYBR Green Master Mix (Applied Biosystems) and WHO/Corman primers targeting N and RdRp ...
-
bioRxiv - Biophysics 2022Quote: ... We transformed the recombination reaction products into CcdB-sensitive One Shot Stbl3 chemically competent cells (Invitrogen) and confirmed correct insertion by Sanger sequencing ...
-
bioRxiv - Immunology 2020Quote: ... PCR reactions were pooled and products were cloned using the Zero Blunt PCR cloning kit (Invitrogen) and plasmids from individual colonies were sequenced using M13 universal primers (forward ...
-
bioRxiv - Immunology 2022Quote: ... TRA and TRB product was generated in separate PCR reactions using Phusion Flash (Thermo Fisher Scientific), Smartseq2modified PCR primer (Eurogentec ...
-
bioRxiv - Genetics 2021Quote: ... The amplified product was recombined into Gateway entry vector pDG15 through a BP recombination reaction (Invitrogen), then plasmid pXWC29 was generated ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction products were visualized on a 1% agarose gel using SYBR Safe stain (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... The attB-flanked PCR products were cloned into pDONR221 vector by BP Gateway reaction (Invitrogen™) to generate entry clones ...
-
bioRxiv - Biochemistry 2022Quote: ... Reaction products were separated on a Novex Bis-Tris 4–12% SDS−PAGE gel (Life Technologies) in order to identify suitable cross-linker concentrations ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The reaction product was diluted 8-fold with 0.1×TE Buffer pH 8.0 (12090-015, Invitrogen). The PCR reactions were conducted using TaqMan Universal Master Mix II (4440040 ...
-
bioRxiv - Microbiology 2024Quote: ... Products of the binding reaction were separated on 6% native polyacrylamide gels using 0.5x TBE (Invitrogen). BKPyV ...
-
bioRxiv - Immunology 2020Quote: ... followed by stopping the reaction using 1M sulphuric acid (100 μl/well) (Cat # Q29307, Thermofisher). The plate was read at 450 nm using a microplate absorbance reader (Synergy H1 multimode plate reader ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction was stopped with 50 ul of 2M Sulfuric Acid (A300S-500, Fisher Scientific). The plates were analyzed by 450 nm absorbance with a Synergy H1 microplate reader (BioTek Instruments ...
-
bioRxiv - Developmental Biology 2022Quote: PCR products were used as templates for T7 transcription reactions with the 5× MEGAscript T7 kit (Ambion). dsRNA was injected dorsally in 0-1 hour old embryos from the stocks w ...
-
bioRxiv - Biophysics 2021Quote: ... reaction with the PCR product and an XhoI/HindIII-digested pBAD/His-B vector (Thermo Fisher Scientific). Using pBAD-GCaMP6s as the template ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were used as templates for the T7 transcription reactions with the MEGAscript T7 kit (Ambion). dsRNA was isolated using phenol/chloroform extraction and isopropanol precipitation ...
-
bioRxiv - Systems Biology 2023Quote: ... PCR products were transferred into pDONR221 by Gateway BP reaction (using BP clonase II enzyme mix, Invitrogen) according to the manufacturer’s instructions to generate entry clones ...
-
bioRxiv - Cell Biology 2022Quote: ... The attB-flanked PCR products were cloned into pDONR221 vector by Gateway BP Clonase II reaction (Invitrogen) to generate entry clones ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product was cloned into pDONRP2R-P3 via a Gateway BP Cloning reaction (Thermo Fisher Scientific). A single missense mutation identified in the resulting plasmid and the parental fosmid was repaired by site-directed mutagenesis using primers AFS436 (/5Phos/TGAGTACTGAGAACTATGGTGTTTC ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting polymerase chain reaction (PCR) product using Phusion High-Fidelity DNA Polymerase (Thermo Scientific F-5345) was examined on an agarose gel ...
-
bioRxiv - Immunology 2021Quote: ... The reaction was quenched with equal volume stop solution containing 0.16N sulfuric acid (Thermo Fisher Scientific). Plates were read using a spectrophotometer (BioTek Instruments Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... This product was subsequently used as the template for a dsRNA synthesis reaction (MegaScript RNAi, Thermo Fisher Scientific). dsRNA was DNase treated ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were directly used in a transcription reaction with T7 polymerase using the MEGAscript transcription kit (Ambion). The reaction was placed in boiling water and allowed to cool to room temperature to promote annealing ...
-
bioRxiv - Microbiology 2022Quote: ... Purified PCR products were used directly for cycle sequencing reactions (BigDye Terminator v3.1 Cycle Sequencing Kit, Applied Biosystems) which were purified using NucleoSEQ columns (Macherey-Nagel ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 2 μL of cell-free reaction product was diluted into 48 μL of Ambion nanopure water (Invitrogen, USA). The solution was then placed in a Costar 96-well black assay plate (Corning ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions were pooled (5 μl each) and the pooled products were cleaned using GeneJet PCR purification kit (ThermoFisher). Amplified barcodes were sequenced using an Illumina HiSeq 4000 with Illumina TruSeq primers ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing reactions using purified RT-PCR products were performed with BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems) using standard cycling parameters ...
-
bioRxiv - Biochemistry 2022Quote: Products were resolved by spotting 1 μL of quenched reactions onto polyethyleneimine (PEI) TLC plates (Fisher Scientific M1055790001). TLC plates were developed in 0.3 M potassium phosphate ...
-
bioRxiv - Genomics 2023Quote: ... The product was subsequently transferred into a pDONR223 entry clone via a Gateway BP reaction (Thermo Fisher Scientific), and transferred to a destination vector (pDEST_HC_Rec_Bxb_v2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A BP reaction was performed to insert the attB site-flanked PCR product into a pDONR221 (ThermoFisher Scientific) entry clone (pDONR221_ADAMTS7) ...
-
bioRxiv - Cancer Biology 2023Quote: ... was performed using 4.5µL of 5-fold diluted RT product and 5.5µL of reaction mix (composed of 5µL of TaqMan Universal Master Mix (Applied Biosystems, Life Technologies ...
-
bioRxiv - Genetics 2022Quote: ... PCR products were used as templates in an RNA transcription reaction using the MEGAscript T7 Transcription kit (Invitrogen) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... The digestion reaction product was run on a 1% agarose gel with 1x SYBR Safe (Thermo Fisher Scientific) and the digested band was extracted from the gel with the GeneJet gel extraction kit (Thermo Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... The labelling reaction was quenched by diluting the samples with 1% trifluoroacetic acid (TFA; Thermo Fisher Scientific), 0.4 M TCEP ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5ul of the PCR product was used in a 20ul in vitro transcription reaction using Megascript T7 kit (Ambion). dsRNA was purified by Phenol/Chloroform extraction followed by ethanol precipitation as described previously [71].
-
bioRxiv - Cell Biology 2022Quote: ... Reaction products were digested with TURBO DNase at 37°C for 15 min and purified (MEGAclear Kit; Life Technologies). Eluates were incubated at 68°C for 10 minutes followed by 37°C for 30 minutes to generate double-stranded RNA (dsRNA).
-
bioRxiv - Physiology 2020Quote: ... 12.5 ng of the RT reaction product was amplified in duplicate using Fast SYBR Green master mix (Applied Biosystems). Real-time PCR was performed on a StepOne Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction products were analysed on an ABI PRISM 3130 instrument using Peak Scanner 1.0 software (Applied Biosystems, CA). Processivity was calculated as described in Ricchetti et al ...
-
bioRxiv - Neuroscience 2023Quote: ... reaction volumes were scaled to 25 μL.43 The PCR product was denatured in HiDi Formamide (Thermo Fisher Scientific) and run in triplicate on ABI3730XL Genetic Analyser with MapMarker ROX 1000 (Bioventures ...
-
bioRxiv - Cell Biology 2024Quote: ... we performed a BP reaction cloning attB-zact product into a donor vector pDONR221 (BP Clonase II, Invitrogen, 11789020). The subsequent LR reaction (LR Clonase II ...
-
bioRxiv - Microbiology 2024Quote: ... 200 μl of 0.25% SDS in nuclease-free water were added to each and RNA products were isolated by extraction with 250 μl of acid-phenol:chloroform (Invitrogen). After the addition of 170 mM NaCl and 15 μg glycogen (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used 20-30 ng of cDNA and the reaction mixture with SYBR Green nucleic acid staining (Invitrogen) on a CFX96 of CFX384 Real-Time systems (Bio-Rad) ...
-
bioRxiv - Biochemistry 2021Quote: ... Reaction products were separated by gel electrophoresis on 4-12% Bis-Tris gradient gels using MES SDS running buffer (Invitrogen) and stained with Flamingo fluorescent protein stain (Bio-Rad) ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... The PCR product was inserted into pInducer20-CRSmut via a combined BP/LR Gateway recombination reaction utilizing pDONR221 as intermediate vector (Invitrogen, Thermo Fisher Scientific Inc. ...