Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 6 chloro 3 nitropyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: hSSB1 and INTS3 proteins were labeled using AF647 dye (Alexa Fluor 647 carboxylic acid succinimidyl ester, Thermo Fisher). The storage buffer was exchanged by dialysis to labeling buffer containing 50 mM MES pH 6.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2020Quote: Recombinant GST-tagged PH-domain of PLCd detecting the membrane lipid PI(4,5)P2 was produced and conjugated to of amine-reactive Alexa Fluor 647 carboxylic acid succinimidylester (Invitrogen) as previously described49 ...
-
bioRxiv - Cancer Biology 2023Quote: Cyclic RGD conjugated MPIO were prepared using 1 μm diameter Dynabead MyOne carboxylic acid MPIO (65011, Fisher Scientific, UK). MPIO were washed in MES buffer and resuspended ...
-
bioRxiv - Biochemistry 2024Quote: ... and G3BP1 were labeled on their N-termini with AF488 (Alexa Fluor 488 carboxylic acid succinimidyl ester, Thermo Fisher). Storage buffer was exchanged to Labeling buffer (50 mM MES pH 6.5 ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Physiology 2023Quote: ... with or without 0.1uM 6-Hydroxyhexanoic acid (6-HHA, ThermoFisher, B24857.03).
-
bioRxiv - Cell Biology 2022Quote: ... Fluorescently tagged G-actin was prepared by covalent modification with Alexa Fluor™ 594 Carboxylic Acid (Thermo Fisher Scientific 15461054) (Alvarado and Koenderink ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were stained with 300 nM 4’,6-diamidino-2-phenylindole nucleic acid stain (DAPI; Invitrogen) in PBS for 5 min followed by washing three times in PBS at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Cell Biology 2021Quote: ... A 10 μl aliquot of Spike S1 at 1 mg/ml as provided by the manufacturer was incubated for 20 min at r.t in the presence of a 10-fold molar excess of FITC or a 7-molar excess of Alexa Fluor 488 carboxylic acid succinimidyl ester (CASE) dye (ThermoFisher Scientific). Afterwards ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to 1 mg (1.25 μmol, MW ~ 800) of the Alexa-Fluor®-647 carboxylic acid succinimidyl ester (Invitrogen/ThermoFisher Scientific). The reaction mixture was stirred for 5 h at room temperature in the dark ...
-
bioRxiv - Biophysics 2020Quote: ... Pab1 RRM12 and Pub1 RRM123 proteins were purified as described above and were labelled with Alexa Fluor 488 or Alexa Fluor 647 carboxylic acid succinimidyl ester dyes (Molecular Probes), using protein to probe ratios of 1:3 ...
-
bioRxiv - Immunology 2023Quote: ... The 14.4.4 mAb and the I-Ak-reactive 11-5.2 mAb were randomly labeled via available lysine residues with Alexa Fluor 647 carboxylic acid succinimidyl ester (Thermo Fisher Scientific) according to the manufacturer’s instructions and purified via gel filtration (Superdex-200 10/300 GL ...
-
bioRxiv - Biochemistry 2023Quote: INIP and the TRR complex were labeled on N-termini using AF488 dye (Alexa Fluor 488 carboxylic acid succinimidyl ester, Thermo Fisher). Before labeling ...
-
bioRxiv - Immunology 2023Quote: 4CMenB OMVs were fluorescently labelled targeting lysine residues with Alexa Fluor 488 (Alexa Fluor 488 carboxylic acid, succinimidyl ester, Invitrogen, A20000). OMVs were concentrated to 20 mg/ml in PBS 1× pH 7.2 ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA was then heated to 55 °C and held for 45 min before purification using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Physiology 2024Quote: ... / bromo-chloro-indolyl phosphate (Thermo Scientific) in AP buffer or using Naphtol AS-MX phosphate and Fast Red (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... flushed with argon prior to adding hydrochloric acid (3 mL of 6 M sequencing grade solution; Thermo Scientific #PI24308). Sealed tubes were kept at 125° C for 48h (oil bath ...
-
bioRxiv - Cell Biology 2021Quote: ... were separated using NuPAGE Bis-Tris gels (4 – 12 %) with 3-(N-morpholino)propanesulfonic acid (MOPS) or 2-(N-morpholino)ethanesulfonic acid (MES) running buffer (Thermo Fisher Scientific) followed by transferring to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Biophysics 2020Quote: ... The confocal parameters were calibrated daily by measuring the FCS decay of a 20 nM TAMRA (carboxylic acid of tetramethyl rhodamine) free dye solution (Molecular Probes, Inc.) with a known diffusion coefficient (D = 420 μm2s−1 ...
-
bioRxiv - Biophysics 2021Quote: ... Fluorescent actin was prepared by labelling monomers with Alexa Fluor 649 carboxylic acid succinimidyl esther (Molecular Probes, Life Technologies, Carlsbad, CA, USA). Before use ...
-
bioRxiv - Biophysics 2021Quote: ... Fluorescent actin was prepared by labelling monomers with Alexa Fluor 649 carboxylic acid succinimidyl esther (Molecular Probes, Life Technologies, Carlsbad, CA, USA). Before use ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to 1 mg (1.25 μmol, MW ~ 800) of the Alexa-Fluor®-647 carboxylic acid succinimidyl ester (Invitrogen/ThermoFisher Scientific). The reaction mixture was stirred for 5 h at room temperature in the dark ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Plant Biology 2024Quote: ... or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside, W5376C; Thermo Fisher Scientific, Guilford, CT). GUS and/or LacZ-stained tissues were cleared for 30 s with 12 % sodium hypochlorite solution before microscopy observations.
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Neuroscience 2019Quote: The PSR1 beads were generated by chemical conjugation of a thiolated PSR1 peptoid derivative to magnetic beads (Dynabeads™ M-270 Carboxylic Acid, Invitrogen, Carlsbad CA) as described previously and were provided as a 30mg/ml suspension of beads in bead storage buffer (1xPBS with 0.1% Sodium Azide ...
-
bioRxiv - Biophysics 2022Quote: ... Fluorescent G-actin was prepared by labelling G-actin with AlexaFluor 488 carboxylic acid succimidyl ester (Invitrogen, through Thermo Fisher Scientific, Cat. # A20000) following Ref ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Immunology 2022Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2023Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Biochemistry 2019Quote: ... fluorescent probes Prodan (6-propionyl-2[dimethylamino]-naphthalene) and ANS (1-anilinonaphthalene-8-sulfonic acid) were also from Invitrogen; PMB ...