Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 6 O TOLYL IMIDAZO 2 1 B THIAZOLE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2022Quote: ... o-nitrophenyl ethylene glycol tetraacetic acid (NP-EGTA, Molecular Probes), pre-mixed with Ca2+ was loaded into pillar cells through the patch pipette ...
-
bioRxiv - Genetics 2022Quote: ... 2% B-27 and 1% N-2 supplements (Life Technologies) and supplements 20ng/ml BDNF ...
-
bioRxiv - Microbiology 2022Quote: ... 2% B-27 and 1% of N-2 supplements (GIBCO), 1% L-glutamine ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% B-27 and 1% of N-2 supplements (GIBCO), 1% L-glutamine ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to 1 mg (1.25 μmol, MW ~ 800) of the Alexa-Fluor®-647 carboxylic acid succinimidyl ester (Invitrogen/ThermoFisher Scientific). The reaction mixture was stirred for 5 h at room temperature in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... Wnt3a proteins were immobilized to 2.8 μm carboxylic acid–coated Dynabeads® (cat. num. 14305D, ThermoFisher), as described before (Habib et al. ...
-
bioRxiv - Immunology 2020Quote: ... The dyes were purchased as NHS ester derivatives: Alexa Fluor 405 Carboxylic Acid Succinimidyl Ester (Invitrogen), Cy3 mono-Reactive Dye Pack (GE HealthCare) ...
-
bioRxiv - Genomics 2021Quote: ... Size-selection and cleanup were accomplished using CA-magnetic beads (Dynabeads® MyOne Carboxylic Acid, Invitrogen), and 11-11.5% PEG 6000 (Sigma-Aldrich © LLC) ...
-
bioRxiv - Bioengineering 2024Quote: ... Concentration of C2 to C6 carboxylic acids and alcohols were analyzed by gas chromatography (Thermofisher, USA) using a Stabil-wax™ column with a length of 25 m and internal diameter of 0.2 μm ...
-
bioRxiv - Immunology 2022Quote: ... Primary B cells were plated at 2-3×106 cells/ml in primary B cell medium (DMEM (Gibco) containing 10% FBS (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
Salmonella actively modulates TFEB in murine macrophages in a growth-phase and time-dependent mannerbioRxiv - Cell Biology 2023Quote: ... or rabbit anti-Salmonella O antiserum group B antibodies (Fisher Scientific, ON) at 1:500 ...
-
bioRxiv - Bioengineering 2019Quote: ... medium was switched to a B27-based Retinal differentiation medium (BRDM) (DMEM/F12 (3:1) with 2% B27 (w/o vitamin A, ThermoFisher Scientific, USA), 1x NEAA and 1x AA) ...
-
bioRxiv - Biochemistry 2021Quote: ... 2′-(or-3′)-O-(N-Methylanthraniloyl) adenosine 5′-triphosphate (mant-ATP, Thermo-Fisher Scientific, Waltham, MA, USA) was serially diluted to concentrations of 5 -15 μM in assay buffer and added to the myosin at a final concentration of 1X -1.2X the final concentration of myosin ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to 1 mg (1.25 μmol, MW ~ 800) of the Alexa-Fluor®-647 carboxylic acid succinimidyl ester (Invitrogen/ThermoFisher Scientific). The reaction mixture was stirred for 5 h at room temperature in the dark ...
-
bioRxiv - Bioengineering 2021Quote: Protein supernatants were then labelled with Alexa Fluor® 555 carboxylic acid succinimidyl ester (AF555) (ThermoFisher Scientific) essentially as previously described [76] ...
-
bioRxiv - Biophysics 2022Quote: ... Fluorescent G-actin was prepared by labelling G-actin with AlexaFluor 488 carboxylic acid succimidyl ester (Invitrogen, through Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... The dyes used for labelling were NHS ester derivatives: Alexa Fluor 405 Carboxylic Acid Succinimidyl Ester (Invitrogen), Cy3 mono-Reactive Dye Pack (GE HealthCare) ...
-
bioRxiv - Biochemistry 2024Quote: hSSB1 and INTS3 proteins were labeled with AF647 (Alexa Fluor 647 carboxylic acid succinimidyl ester, Thermo Fisher). Proteins were dialyzed against Labeling buffer (50 mM MES pH 6.5 ...
-
bioRxiv - Microbiology 2024Quote: ... and 3% amphotericin B (Gibco)) ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Biochemistry 2019Quote: ... fluorescent probes Prodan (6-propionyl-2[dimethylamino]-naphthalene) and ANS (1-anilinonaphthalene-8-sulfonic acid) were also from Invitrogen; PMB ...
-
bioRxiv - Biochemistry 2023Quote: hSSB1 and INTS3 proteins were labeled using AF647 dye (Alexa Fluor 647 carboxylic acid succinimidyl ester, Thermo Fisher). The storage buffer was exchanged by dialysis to labeling buffer containing 50 mM MES pH 6.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Bioengineering 2020Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Microbiology 2019Quote: ... 2% B-27 (Gibco), and 100 ng/ml neuronal growth factor (NGF ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2% B-27 (Gibco), 1.5% glutamine (Gibco) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2% B-27 (GIBCO), 1 mM sodium pyruvate MEM (GIBCO) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2% B-27 (Thermofisher) 2 mM GlutaMAX® (Thermofisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 (ThermoFisher), 4.8 μg/mL 5-Fluoro-2’-deoxyuridine (Sigma) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... 2% B-27 (Gibco), 1% GlutaMAX (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Microbiology 2024Quote: ... 1% N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (HEPES, Gibco, #15630080) and 1% MEM nonessential amino acids (MEM-NEAA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Immunology 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Invitrogen) and 2-mercaptoethanol (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... B -3 days (Neurobasal media (Gibco) + N2 supplement (Gibco ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Peptides were eluted along an optimized 90 min gradient from 6 to 40% Mixture B (80% ACN/0.5% formic acid) with an EASY-nLC 1,200 system (Thermo Fisher Scientific). Spray voltage was set to 2.2 kV ...
-
bioRxiv - Molecular Biology 2020Quote: ... media containing 2% B27 supplement (w/o insulin, Gibco), and additional recombinant factors including Activin A (100ng/ml ...
-
bioRxiv - Biophysics 2020Quote: Recombinant GST-tagged PH-domain of PLCd detecting the membrane lipid PI(4,5)P2 was produced and conjugated to of amine-reactive Alexa Fluor 647 carboxylic acid succinimidylester (Invitrogen) as previously described49 ...
-
bioRxiv - Biochemistry 2024Quote: ... and G3BP1 were labeled on their N-termini with AF488 (Alexa Fluor 488 carboxylic acid succinimidyl ester, Thermo Fisher). Storage buffer was exchanged to Labeling buffer (50 mM MES pH 6.5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... exchanging half of the media with Serum-Free medium (DMEM w/o Phenol Red-GIBCO-, 25mM HEPES, L-Glu, Pen/Strep, 1% glucose, B-27 and N2 supplement-GIBCO-) every 2 days ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...