Labshake search
Citations for Thermo Fisher :
9651 - 9700 of 10000+ citations for Heme oxygenase 1 HO 1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... media was replaced with 1:1 blend of bNIM and Media 231 (Life Technologies #M-231-500) supplemented with smooth muscle growth supplement (SMGS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4 µg of cDNA was transfected using a 1:1 ratio of cDNA: Lipofectamine 2000 (52887, Invitrogen) in OPTI-MEM transfection medium ...
-
bioRxiv - Neuroscience 2021Quote: ... NMM is a 1:1 mixture of DMEM/F12 and Neurobasal™-AMedium (both from Gibco Inc.) supplemented with N-2 Supplement and B-27™ Supplement (Gibco Inc.) ...
-
bioRxiv - Biochemistry 2020Quote: ... SH-SY5Y (ECACC) neuroblastomas were maintained in 1:1 DMEM:F12 (Thermo Fisher Scientific Cat# 11-039-021) containing 10% FBS and streptomycin and penicillin (10 μg/ml ...
-
bioRxiv - Bioengineering 2021Quote: ... It was prepared with pH adjusted to 7.4 using 1 M hydrochloric acid (Fisher Scientific, SA48-1). Small quantities of the 4-AP stock solution were added to the modified Tyrode’s perfusion solution and perfused for 10 min to reach a final working concentration of 5.6 mM.
-
bioRxiv - Microbiology 2020Quote: ... 1% penicillin (100 unit/ml) and 1% streptomycin (10 mg/ml; all were from Gibco, Rockford, USA) in a 5% CO2 at 37°C condition ...
-
bioRxiv - Microbiology 2020Quote: ... were orally challenged with 100 µl DPBS containing 1·109 fluorescent polystyrene beads (1 µm) (Thermo Fisher) plus 5·108 CFU Ye wt in order to simulate infection conditions ...
-
bioRxiv - Bioengineering 2021Quote: ... and sub-cultured (1:30 dilution) in tryptone broth (TB, 10 g L-1 Bacto Tryptone; ThermoFisher) for 2.5 h (37°C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation for 1 h with goat anti-rabbit AF647 (1:400; A-21224, Molecular Probes) or goat anti-mouse AF488 (1:200 ...
-
bioRxiv - Microbiology 2019Quote: ... 1 μl of this primer pool was added to 1 μl of 10 mM dNTP mix (Invitrogen) and 11 μl of RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... humidified chamber for 1 h with anti-mouse coupled to Alexa Fluor 488 (1:1000, Invitrogen, A11001), anti-rabbit coupled to Alexa Fluor 555 (1:1000 ...
-
bioRxiv - Biochemistry 2020Quote: ... OC antibody of 1:25,000 and A11 antibody of 1:500 (Millipore and Life Technologies, respectively; (34)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 10% heat-inactivated FBS and 1% antibiotic/antimycotic and 1 ng/mL Dihydrotestosterone (DHT) (Life technologies). MDA-PCa-2b cells (RRID:CVCL_4748 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were blocked and permeabilized in a solution containing 1:1 Odyssey blocking buffer (LiCor)/PBS (Invitrogen) with 0.1% Triton X-100 (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... EqMaOs were blocked with anti-goat blocking solution (TBS + 1% BSA +1-% normal goat serum (Thermo Fisher). Anti-cytokeratin (CK ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1 hour in secondary antibody (1:500, Alexa Fluor 568 donkey anti-mouse antibody, (Thermo Fisher Scientific Cat# A10037 ...
-
bioRxiv - Physiology 2022Quote: ... -rat and –guinea pig secondary antibodies at RT for 1 hour on a nutator (1:500, ThermoFisher, #A21206 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-Lef1 (1:100, Cell Signaling 2230S, and rabbit anti-Claudin 11 (1:100, Thermofisher, PIPA568608), and chicken anti-RFP (1:200 ...
-
bioRxiv - Biochemistry 2022Quote: ... All media were supplemented with 100 U ml−1 penicillin and 100 μg ml−1 streptomycin (Gibco). Fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... there was a full medium change to SCM2 medium (Advanced DMEM/F12 (1:1): Neurobasal A (Gibco) (50:50 ...
-
bioRxiv - Immunology 2022Quote: K562 cells were cultured in 1:1 (v/v) mixture of RPMI 1640 (Gibco, Catalog no. 22400089) and IMDM (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were lysed by addition of a 1:1 mixture of Hanks’ Balanced Salt Solution (HBSS; Gibco) and Britelite plus reagent (PerkinElmer) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Secondary antibody anti-rabbit A555 was incubated at room temperature for 1 h (1:500, Life Technologies). Nuclei were stained using DAPI (Sigma) ...
-
bioRxiv - Bioengineering 2022Quote: ... and F-actin filaments were stained using phalloidin (Merck; 1:500 and Thermo Fisher Scientific; 1:40). Samples were then washed with PBS and stored at 4 °C before imaging.
-
bioRxiv - Genetics 2022Quote: ... samples were denatured in 1:1 with 2 x SDS buffer with 1x reducing agent (Invitrogen, NP0004) for 10 min at 95 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by 1 h blocking and overnight incubation in either anti-chicken Alexa 488 (1:500, Invitrogen) or Cy5 anti-rabbit (1:500 ...
-
bioRxiv - Immunology 2020Quote: ... and cells were subsequently overlaid with a 1:1 mixture of 1.2% agarose (ThermoFisher Scientific, #16500-100) and supplemented 2x MEM (2x MEM (ThermoFisher Scientific #11935046 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were resuspended in 1% BSA-PBS +0.1% NP-40 with 1 μg/mL DAPI (Life Technologies) and 100 μg/mL RNAse A (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking was achieved by incubating the beads with 1mg.mL-1 of Ultrapure BSA and 0.5mg.mL-1 of salmon sperm DNA (Invitrogen) overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... and combined with 50μl 1× D-Luciferin Working Solution supplemented with 1× Firefly Signal Enhancer (Thermo Scientific Pierce Firefly Signal Enhancer ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the sensory epithelium was harvested and immersed in 1 μM FM 1-43FX (PA1-915, ThermoFisher) dissolved in HBSS (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibody (donkey anti mouse Alexa 488 1:1000, donkey anti rabbit Alexa 568 1:1000 (Invitrogen)) incubation was proceeded in the same way in cross sections and teased fibers ...
-
bioRxiv - Immunology 2019Quote: ... Protein A and Protein G coupled magnetic beads (mixture 1:1, Dynabeads, Thermo Fisher, 10002D and 10004D) were pretreated with BSA (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 μl of N-methyl-N-trimethylsilyl trifluoroacetamide (MSTFA, Pierce) with 1% trimethylchlorosilane (1% TMCS, Thermo Scientific) was added to react for 30 min in 60°C ...
-
bioRxiv - Immunology 2020Quote: ... gp120 in PBS (200μg/ml for 100μl/20μg/mice) was mixed at a 1:1 ratio with Alhydrogel 2% (Invitrogen) and injected intraperitoneally ...
-
bioRxiv - Cancer Biology 2021Quote: ... EGFR (#4267, 1:1000 dilution, Cell Signaling; clone H11 #MA5-13070, 1:500 dilution, Fisher Scientific, France), pERK1/2 (Thr202/Thr204 ...
-
bioRxiv - Biochemistry 2021Quote: ... and 100 U ml−1 penicillin and 100 μg ml−1 streptomycin (Gibco, Cat. no. 15140-122). Stable cell lines expressing N-terminal Flag tagged receptor constructs in pcDNA3.1 vector were generated by transfecting HEK-293 cells with 7 μg of plasmid DNA using polyethylenimine (PEI ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 20 mg/mL RNAse A and 1 U/μL DNAse (Invitrogen, Carlsbad, CA, USA) were added to 1 mL of the filtered lysates to limit contamination by host nucleic acids ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complexes were captured with a 1:1 mixture of magnetic Protein A and Protein G Dynabeads (Invitrogen) for 3 h at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in 1% Triton-X in PBS with FITC rabbit anti-mouse IgG1 (1:400, Invitrogen A21121) and Alexa fluoro-568 conjugated a-bungarotoxin (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 μL was spotted on a 1% agarose pad poured in a Gene Frame (Thermo Fisher). Pads were sealed with a coverslip inside the anaerobic chamber ...
-
bioRxiv - Genetics 2022Quote: ... 24-well plates containing 500 µL of antibiotic-free (DMEM)/F12 (1:1) GlutaMAX™ (ThermoFisher Scientific) were incubated at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... WB 1:20 000) and Protein A HRP–conjugated were purchased from Invitrogen (WB 1: 20 000). The HALO-Trap Agarose beads and V5-conjugated beads were purchased from ChromoTek and Sigma ...
-
bioRxiv - Genomics 2019Quote: ... 1 µg of each of the samples was combined with 5 µg Cot-1 DNA (15279011, ThermoFisher) and 1 µl of 1mM blocking oligo (5’ AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAA 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... were grown in a 1:1 mixture of DMEM and Ham’s F-12 medium (DMEM:F-12)(Gibco) and supplemented with 10% FBS and with penicillin streptomycin ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were transfected with 1:1 mEmerald-Zyxin-6 to mCherry-Paxillin-22 using Lipofectamine 3000 (ThermoFisher) per the manufacturer’s protocol and allowed to grow for 24 hours ...
-
bioRxiv - Bioengineering 2019Quote: ... # P9416)/1× PBS) and blocked in staining buffer containing 1% bovine serum albumin (BSA, Thermo Fisher Scientific, 37525) for 30 minutes ...
-
bioRxiv - Physiology 2020Quote: ... 1 μM) for 0.5 to 1 hour in DMEM containing 10% of charcoal stripped serum (Gibco, 12676029). Total protein extract was obtained in cell lysis buffer containing 50 mM Tris-HCL (pH 7.5) ...
-
bioRxiv - Microbiology 2019Quote: ... 1/10 volume of 3 M Sodium Acetate (pH 5.2) and 1 μl of GlycoBlue (Life Technologies). The precipitate was pelleted by centrifugation (30 min ...
-
bioRxiv - Pathology 2019Quote: ... then incubated in secondary antibody (goat anti-mouse Alexa488 1:200, Alexa555-phalloidin 1:100, ThermoFisher Scientific) diluted in PBTA overnight ...