Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Transcripts abundance was determined by reverse transcription quantitative PCR (qRT-PCR) using the SYBR® Green RT-PCR assay (Applied Biosystems). Amplification ...
-
bioRxiv - Microbiology 2020Quote: ... and quantitative real-time RT-PCR (qRT-PCR) was performed using the ViiA 7 real-time PCR detection platform (Applied BioSystems). Primers were based on previous studies (Ding et al. ...
-
bioRxiv - Pathology 2019Quote: ... and quantitative real-time RT-PCR (qRT-PCR) was performed using the ViiA 7 real-time PCR detection platform (Applied BioSystems). All gene specific primers used for qRT-PCR were evaluated by BLASTN search against the Fg and Bd genomes to exclude unspecific annealing and are listed in Supplemental Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and 9.25 µL sterile water using the standard Power SYBR Green PCR Master Mix RT-PCR Protocol (Protocol Number 436721) on a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher). As positive controls for the WSP and WPCP primer sets ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time polymerase chain reaction (RT-PCR) was performed using SYBR Green PCR Master mix (Applied Technologies) on QuantStudio3 Real-Time PCR System (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR (qRT-PCR) was performed on the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA) using the QuantiTect SYBR Green® RT-PCR kit (204243 ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative RT-PCR was performed using a standard TaqMan® PCR protocol on a StepOne real time PCR System (Applied Biosystems) with primers specific for murine Dag1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Twenty thousand cells were plated and then transfected with pre-miR-100 or control miRs in combination with the SMRT/NCOR2 expression vector (pSMRT, Fisher Scientific) after 1 day of growth ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... were co-transfected with the EGFP-Caspase 2 or EGFP-Δ Caspase 2 plasmid and the synthesized miR-2 (miR-2-mimic) using Cellfectin II transfection reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... miR-504-3p or miR-574-5p were reverse transcribed by using TaqMan™ Advanced miRNA cDNA Synthesis Kit (Thermo Scientific) and then amplified by using specific primers provided in the TaqMan Advanced miRNA Assays (Thermo Scientific ...
-
bioRxiv - Immunology 2020Quote: ... and the synthesized miR-137 or miR-7847 (50 nM/well) were co-transfected into S2 cells using with Cellfectin II Reagent (Invitrogen, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2’-O-methylated miRNA mimics matching the exact sequence of miR-125b and the adenylated miR-125b were obtained from Applied Biosystems and transfected into cells at a concentration of 20 nM ...
-
bioRxiv - Pathology 2020Quote: ... 100 ng of wild-type or mutant reporter vectors were co-transfected with 20 nM miRNA (miR-574-5p or miR-574-3p) into HEK293T cells cultured in 24-well plate using lipofectamine 3000 (ThermoFisher Scientific) following the manufacturer’s instruction ...
-
bioRxiv - Immunology 2021Quote: ... Taqman miRNA assays for the housekeeping control gene U6 snRNA (#001973) and hsa-miR-21-5p (which also recognizes mmu-miR-21a-5p) (#000397) were purchased from Thermo Fisher. qPCR was performed using Taqman Universal Master Mix II ...
-
bioRxiv - Physiology 2023Quote: ... myotubes were transfected with either 20nM of miR-30a or miR-30c mimics or 20 nM of a mimic scramble (mirVana™ miRNA mimics, ThermoFisher) using Lipofectamine® RNAiMAX Transfection Reagent (Ambion ...
-
bioRxiv - Cancer Biology 2023Quote: ... the expression of miR-214 in HNSCC cells was silenced using a pre-designed anti-miR-214 inhibitor (Thermofisher, Waltham, MA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... extravesicular cDNA was pre-amplified for all miRNA except the spike ath-miR-159 by 10-14 cycles of PCR using Taqman probe reagent (Solisbiodyne, Tartu, Estonia) and Taqman assays (Fisher Scientific), followed by 40 cycles of PCR on an ABI7300 instrument (Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Real-time PCR of miR expression was carried out in a final volume of 10 µl using TaqMan MicroRNA Assays (Applied Biosystems) and normalized on RNU48 and RNU49 as endogenous controls ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse Transcription and quantitative PCR of mature miR-211 from total RNA was performed with TaqMan small RNA Assay (Applied Biosystems) according to the manufacturer’s instruction and carried out on Quant Studio 6 Flex System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: Fragments of the 3’UTR regions of predicted miR-324 targets were PCR amplified (using Phire Hot Start II DNA Polymerase; ThermoFisher Scientific) from murine genomic DNA or osteoblast cDNA and cloned by In-Fusion HD cloning (Takara Bio ...
-
bioRxiv - Immunology 2022Quote: ... followed by staining for 30 minutes with antibodies to the different TF at RT using the Foxp3/TF staining buffer set (ThermoFisher). Samples were acquired on the Aurora (Cytek).
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg of RNA was subjected to RT reaction using the SuperScript first-strand synthesis system for RT-PCR (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... One-step RT-qPCR was performed using One-Step Real-Time RT-PCR Master Mixes (Thermo Fisher Scientific, Waltham, USA) and the StepOnePlus Real Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... RT-qPCR analysis was performed using Power SYBR Green RNA to CT 1 step RT-PCR kit (Applied Biosystems, #4389986) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Peptide quantification was done using Pierce™ Quantitative Fluorometric Peptide Assay and equal amount from each sample was labelled using TMTproTM 16plex Label Reagent Set Set (GP2d) or TMTproTM 10plex Label Reagent Set Set (Mia Paca-2) (Thermo Fisher Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies) in a total volume of 50 µl ...
-
bioRxiv - Immunology 2021Quote: ... The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies) in a total volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... Reactions with appropriate oligonucleotides were set-up with SYBR Green PCR Master Mix (Applied Biosystems) and carried out on an ABI 7500 Fast Real-Time PCR System ...
-
bioRxiv - Immunology 2022Quote: ... qPCR reactions were set up using Power SYBR Green PCR Master Mix (Applied Biosystems/ ThermoFisher). Ct values and melt curve analyses were performed in the OHSU Gene Profiling Shared Resource with a QuantStudio 12K Flex system (Applied Biosystems/ThermoFisher).
-
bioRxiv - Immunology 2022Quote: ... qPCR reactions were set up using Power SYBR Green PCR Master Mix (Applied Biosystems/ ThermoFisher). Ct values and melt curve analyses were performed in the OHSU Gene Profiling Shared Resource with a QuantStudio 12K Flex system (Applied Biosystems/ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... The Ig PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Thermo Fisher) in a total volume of 50 µl ...
-
bioRxiv - Microbiology 2019Quote: ... The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies) in a total volume of 50 µl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real time PCR reactions were set up using FastStart Universal SYBR Green Master Mix (Invitrogen) and thermal cycling performed on a StepOnePlus Real-Time PCR System using Step One software v2.0 ...
-
bioRxiv - Neuroscience 2021Quote: ... The reaction was set in the 7900HT Fast Real Time PCR System (Applied Biosystems, USA). qRT-PCR was performed in triplicate ...
-
bioRxiv - Cell Biology 2023Quote: ... Reactions were set in technical triplicates in a StepOnePlus Real-Time PCR system (Applied Biosystems). Relative gene expression was calculated with the 2-ΔΔCt method ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each reaction well was set up using SYBR™ Green PCR Master Mix (Applied Biosystems), 50 nM of each forward and reverse primer and 1 µL of cDNA in a 15 μL reaction volume ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each reaction well was set up using SYBR™ Green PCR Master Mix (Applied Biosystems), 50 nM of each forward and reverse primer and 10 ng gDNA in a 15 μL reaction volume ...
-
bioRxiv - Biochemistry 2020Quote: ... SKP2 (Invitrogen, 32-3300, 1:1000). Antibodies against CKS1 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal (32-5600, ThermoFisher Scientific); cingulin ...
-
bioRxiv - Cell Biology 2023Quote: ... Dsg1 (#32-6000) from Thermo Fisher Scientific ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using SYBR green master mix (Applied Biosystems) on the Viia™ 7 Real-Time PCR system ...
-
bioRxiv - Cell Biology 2020Quote: ... The RT-PCR using the StepOne Plus (Life Technologies, Carlsbad, CA, USA) consisted of incubation at 50°C for 5 min followed by 40 cycles of 95°C for 15 s and of 60°C for 1 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... RT-PCR was carried out using Platinum™ Taq DNA Polymerase (Invitrogen) or Gotaq Master Mix (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... Paris using Ag Path-ID One-Step RT-PCR kit® (Thermofisher). PCR reaction was run on the ABI PRISM® 7900 system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: RT-PCR was conducted using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific). RNA molecules obtained ex vivo were used as templates ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: ... Quantitative RT-PCR was performed using SYBR® green fluorescent dye (Invitrogen). Specific Taqman probes were used for amplification of CD147 (forward 5’-GTCCAGGAAGTCAACTCCAA-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse transcription was performed with the Superscript III RT-PCR Kit (Invitrogen). Quantitative PCR was performed with the SYBR Green PCR Master Mix using the ABI StepOnePlus Sequence Detection System (Applied Biosystems ...
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... RT-PCR reactions were performed using Superscript III reverse transcriptase (Life Technologies). For specific amplification of transgenic invadolysin ...