Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for West Nile Virus Envelope Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... Blot were developed using SuperSignal West Dura (Thermo Scientific, 34076). For comparing KRas levels in PDAC and PDACKRasless cell lines (see Figure 5) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Supersignal™ West Pico Plus Chemiluminescent Substrate (Thermo Scientific 34580) was added for 3 min and the strips were scanned using the Bio-Rad ChemiDocTM Imaging system.
-
bioRxiv - Biochemistry 2023Quote: ... Signal detection was achieved with SuperSignal West Pico (Thermo Fisher) and Kodak X-Omat AR film ...
-
bioRxiv - Neuroscience 2023Quote: ... Following incubation with West Pico ECL substrate (Thermo Fisher Scientific), blots were imaged using the Gel Doc XR+ (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: ... and developed with Supersignal West Femto Maximum Sensitivity Substrate (ThermoFisher) on the G:BOX imaging system (Syngene) ...
-
bioRxiv - Pathology 2023Quote: ... Enhanced chemiluminescence reagent (ECL, Cytiva) or SuperSignal West Femto (ThermoFisher) were used for protein detection ...
-
bioRxiv - Neuroscience 2023Quote: ... or with Super Signal West PICO Plus (Thermo Fisher Scientific) and imaged with iBright 1500 (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2023Quote: ... was used with SuperSignal West Pico PLUS (Thermo Fisher Scientific) for protein detection.
-
bioRxiv - Microbiology 2023Quote: ... treated with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher) and chemiluminescence acquired with a ChemiDoc MP imaging system (Bio-Rad) ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... developed using SuperSignal West Dura Extended Duration Substrate (ThermoFisher Scientific) and visualized by automated chemiluminescence using ChemiDoc XRS+ (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific #34096) with BioRad ChemiDoc XRS system ...
-
bioRxiv - Physiology 2024Quote: ... using SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Scientific, 34580). Primary antibodies used were as follows ...
-
bioRxiv - Developmental Biology 2024Quote: ... or SuperSignalTM West Femto Chemiluminescent Substrate (Thermo Fisher Scientific, PI34095) and analyzed on a ChemiDocTM XRS+ system (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... SuperSignal™ West Pico PLUS reagents were used (ThermoFisher Scientific) to image relative protein amounts using a ChemiDoc Gel Imaging System (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... or SuperSignal West Atto Ultimate Sensivity Chemiluminescent Substrate (Thermo Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... Blots were developed with SuperSignal West Pico Plus (ThermoFisher, 34579) and exposed to autoradiographic films (LabScientific ...
-
bioRxiv - Neuroscience 2023Quote: ... or SuperSignal West Dura Extended Duration Substrate (Thermo Fisher Scientific) and exposure to X-ray films ...
-
bioRxiv - Cell Biology 2023Quote: ... developed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific) and visualised on an Azure 600 chemiluminescence imager (Azure Biosystems).
-
bioRxiv - Cancer Biology 2023Quote: ... and revealed with SuperSignal West femto detection reagent (Thermo Scientific).
-
bioRxiv - Systems Biology 2023Quote: ... or SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific), and quantified using a luminoimage analyzer (Fusion System Solo 7S ...
-
bioRxiv - Cell Biology 2023Quote: ... incubated in Supersignal West Pico PLUS chemiluminescent substrate (Thermo Scientific) for 5 min and exposed to film ...
-
bioRxiv - Cancer Biology 2024Quote: ... SuperSignal™West Pico PLUS chemiluminescent Substrate (Thermo Fisher, 34580) was used to detect bands ...
-
bioRxiv - Neuroscience 2024Quote: ... or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific, 34095) and imaged using ChemiDocX Imager ...
-
bioRxiv - Neuroscience 2024Quote: ... or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher #34095), depending on signal intensity ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the Super Signal West Femto detection solutions (ThermoFisher Scientific). Signals were detected and analyzed with Luminescent Image Analyzer (Las 4000 ...
-
Loss of the mitochondrial citrate carrier, Slc25a1/CIC disrupts embryogenesis via 2-HydroxyglutaratebioRxiv - Developmental Biology 2024Quote: ... SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific, 34577) or SuperSignal™ West Dura Extended Duration Substrate (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... or SuperSignal West Dura extended Duration Substrate (Fisher Scientific 37071). Hyblot CI autoradiography film (Thomas Scientific 1159M38 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and SuperSignal West Atto Ultimate Sensitivity Substrate (38554, Fisher Scientific) to image HES3.
-
bioRxiv - Cancer Biology 2024Quote: ... using SuperSignal West Pico PLUS Chemiluminescent Substrate (PI34577, Fisher Scientific) to image TUBULIN and PAX3::FOXO1/FOXO1 ...
-
bioRxiv - Cell Biology 2024Quote: ... or Pierce SuperSignal West Femto Substrate (Thermo Fisher Scientific; 34094) and ChemiDoc™ Imaging System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... or Pierce SuperSignal West Femto PLUS (Thermo Scientific, cat: 34095) (plakoglobin) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell envelopes were stained by adding 5 µL of 1 mg/mL FM™ 4-64FX (Thermo Fisher Scientific) and non-viable cells stained with 1 µL of the LIVE/DEAD™ cell dye (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA plasmids were co-transfected into HEK293TD cells along with packaging (Δ8.9) and envelope (VSVG) expression plasmids using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Immunology 2019Quote: ... 3 μg guide RNA plasmid was cotranfected into 5 × 106 HEK293T cells with 3 μmg psPAX2 packaging vector and 1.5 μg pMD2.G VSV-G envelope vector using lipofectamine 2000 (Invitrogen). Supernatants were harvested over 72 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2.16 μg of the vector expressing the VSV-G envelope glycoprotein (pMD2.G) were mixed with OptiMEM (Gibco) to a final volume of 400 μl ...
-
bioRxiv - Bioengineering 2022Quote: ... packaging coding vector (pCMVdR8.74) and envelope coding vector (pMD2.G)) was diluted in 250 µL Opti-MEM (Invitrogen, Germany) and 11.25 µL of polyethyleneimine (1 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA plasmids were co-transfected into HEK293TD cells along with packaging (Δ8.9) and envelope (VSVG) expression plasmids using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µg packaging plasmid (psPAX2) and 2.5 µg envelope plasmid (pMD2.G) using Lipofectamine 2000 in OptiMEM (ThermoFisher Scientific). After 6-hr incubation of Lipofectamine/DNA mixture in OptiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... and envelope (pMD2.G; 0.5 µg) plasmids using either FuGENE 6 or Lipofectamine 3000 transfection reagent (both from Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.84 μg of pCMV-VSV-G envelope plasmid, 5.67 μg of pCMV dR8.2 dvpr packaging plasmid in OptiMEM medium, Gibco #31985062) and 1 ml of premix 2 (42.5 μl of Lipofectamine LTX ...
-
bioRxiv - Neuroscience 2021Quote: ... before being washed again and finally visualized using the SuperSignal West Pico PLUS or the SuperSignal West Dura Extended Duration substrates (Thermo Fisher Scientific, #34580 or #34076). Proteins were visualized using the Amersham Imager 600 ...
-
bioRxiv - Plant Biology 2023Quote: ... coupled to the secondary antibody was detected by addition of either SuperSignal West Pico substrate for strong bands or SuperSignal West Femto solution (Thermo Fisher Scientific, Waltham, MA, USA) for faint bands by using ChemiDoc™ XRS+ (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... virus stocks were prepared in serum-free VP-SF media (Invitrogen). Viruses were harvested before CPE development ...
-
bioRxiv - Cell Biology 2021Quote: ... The virus packaging was performed in HEK293FT cells (Thermo Fisher Scientific) based on a calcium precipitation method using pUMVC and pCMV-VSV-G vectors (37 ...
-
bioRxiv - Immunology 2021Quote: ... Virus particles in 2% FBS/DMEM/1mM Pen/Strep (Thermofisher, 15140122) were incubated with cells for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems). According to the manufacturer’s instruction (QIAamp Viral RNA mini kit (Qiagen)) ...
-
bioRxiv - Microbiology 2022Quote: ... using TaqMan Fast Virus 1-Step Master Mix chemistry (Applied Biosystems). SARS-CoV-2 genomic RNA was amplified and detected using forward (5’- CGTGTAGTCTTTAATGGTGTTTCC-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... cells and purified virus particles were lysed with RIPA (ThermoFisher Scientific) buffer supplemented with complete protease inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... TaqMan™ Fast Virus 1-Step Master Mix (4444432, Life Technologies) was used for one-step RT-qPCR and TaqMan Fast Advanced Master Mix (4444556 ...