Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for Recombinant Human ISG15 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: Epidermal growth factor receptor (EGFR) protein expression levels on the surface of Gli36-derived EVs were quantified using an EGFR Human ELISA kit (ThermoFisher Scientific, Waltham, MA). EVs were spiked in healthy donor serum at different concentrations ranging from 0 to 1.0E11 particles/mL while maintaining the serum-derived EV concentration at 1.0E9 particles/mL ...
-
bioRxiv - Immunology 2023Quote: To assess thermodynamic stability of human and bat (M. myotis and M. capaccinii) purified IgG molecules we used Protein Thermal Shift Dye Kit (Applied Biosystems, Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... were determined by matching the UniProt human protein database (release 2023_01) with the acquired fragmentation pattern using Sequest (Thermo Fisher Scientific, Waltham, MA) (Eng et al. ...
-
bioRxiv - Microbiology 2020Quote: ... we used human monoclonal antibodies produced recombinantly in human Expi293F cells (Life Technologies) as described before (Fang et al ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-human IgG-Alexa647 and anti-human IgG-Alexa568 were obtained from Invitrogen, anti-acetylated tubulin (T7451 ...
-
bioRxiv - Cell Biology 2020Quote: ... and human GAPDH and human KIF18A Taqman probes and primers (Thermo Fisher Scientific) were used for reverse transcription and qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and subjected to human total tau ELISA (human tau: # KHB0042, Thermo Fisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen), which was detected using an ECL Advance Western Blotting Detection Kit (Amersham ...
-
bioRxiv - Molecular Biology 2020Quote: Recombinant 6x-His tagged PTB was purified using Ni-NTA agarose (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Recombinant BUD13 purification was confirmed by SimplyBue SafeStain (Thermo Fisher Scientific, LC6060) and western blot using BUD13 antibody (Bethyl Laboratories ...
-
bioRxiv - Immunology 2019Quote: ... slices were overlaid with 50ng recombinant IL-15/IL-15Rαcomplex (Thermo Fisher) in 10□1 of cRPMI following peptide treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant virus was made by co-transfection into SF9 insect cells (Invitrogen) of the plasmid and BacVector3000 baculovirus DNA (Novagen ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2) 1 U/μL RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific). Hydra polyps in MCB buffer were homogenized on ice using a Dounce homogenizer ...
-
bioRxiv - Immunology 2019Quote: ... recombinant macrophage colony-stimulating factor (100 U/ml; ebioscience, Thermo Fisher Scientific) and Pen Strep (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 ng/ml recombinant mouse macrophage colony-stimulating factor (Gibco, Burlington, ON), and penicillin/streptomycin antibiotics ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant plasmid was linearized using the Ncol restriction enzyme (ThermoFisher Scientific) and the MEGAscript® T7 Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and 20 U/ml recombinant interleukin-2 (IL-2; Thermo Fisher Scientific) at 37° C ...
-
bioRxiv - Microbiology 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac expression system (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: HESCs were routinely maintained on recombinant VTN-N Vitronectin (A14700, Life Technologies), also tested on the prototype CTS™ (Cell Therapy Systems ...
-
bioRxiv - Immunology 2022Quote: ... media was additionally supplemented with recombinant murine IL-12p70 (Thermo Fisher Scientific) and recombinant murine IL-18 (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2020Quote: ... The recombinant plasmids were extracted with PureLink Quick Plasmid Miniprep Kit (Invitrogen) from successful clones.
-
bioRxiv - Biochemistry 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac system (ThermoFisher Scientific), and sNrk was expressed in Sf9 cells grown in ESF921 medium (Expression Systems) ...
-
bioRxiv - Immunology 2021Quote: The recombinant baculovirus was amplified in Sf9 cells (Thermo Fisher Scientific, USA) to a density of 2 × 106 cells/mL in ExCell 420 medium (Sigma Aldrich ...
-
bioRxiv - Biophysics 2019Quote: Recombinant APC/C was expressed in High Five insect cells (Thermo Scientific) as described in30,42 ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant bacmids were obtained from Bac-to-Bac system (Life Technologies). Baculoviruses were produced by transfection of bacmid DNA into Sf9 cells and used to infect High Five cells (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were carried out using Recombinant Taq DNA Polymerase (Thermo Scientific) and standard PCR cycling conditions.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant SARS-CoV-2 RBD were purified by nickel affinity columns (Invitrogen) while ACE2-Fc and antibodies were purified by protein A affinity columns (Cytiva ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were used to generate recombinant bacmids according to the manufacturer’s protocol (Invitrogen). Insertion of the gene into the bacmid was verified by PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant bacmid was transfected into Sf9 insect cells using Lipofectamine (Invitrogen) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant plasmids were transformed into INVSc1 Saccharomyces cerevisiae (Thermo Fisher Scientific) using the PEG-LiAc method ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA). 2 μL of ten-fold diluted RNA template in duplicates was added in a total volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) was used ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was diluted to 2.5 μg/mL in PBS (Fisher Scientific) and 100 μl of the dilution was distributed in the wells of flat-bottom 96-well microplates (Immulon 2HB ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...