Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for 6 Bromo 3 4 dihydro 4 phenyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (NBD-PE) was purchased from ThermoFisher (Waltham, MA). Cholesterol Oxidase from Streptomyces was purchased from MP Biomedicals (Santa Ana ...
-
bioRxiv - Genomics 2024Quote: ... and transfer plasmids were transfected at a mass ratio of 2:3:4 with Lipofectamine 3000 (Thermo Fisher Scientific L3000001) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then dipped in the secondary antibody-containing buffer with the nuclear dye 4′,6-diamidino-2-phenylindole (DAPI, Cat# D1306, Life Technologies-Invitrogen, Carlsbad, CA, USA, dilution 1:400), for 2 hours at RT ...
-
bioRxiv - Immunology 2021Quote: ... mixed (1:1 in volume) with Fluo 4 dye (Fluo 4 Direct Calcium Assay Kit, ThermoFisher Scientific) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Physiology 2024Quote: ... Tim-4 (1:1000 dilution, rabbit anti-TIM-4 antibody, Invitrogen, PA5-116045, RRID:AB_2900679) and Lumican (1:1000 dilution ...
-
bioRxiv - Immunology 2022Quote: SMGs were fixed for 6-8 hours in 4% paraformaldehyde (PFA; Thermo Scientific) at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... and passaged every 4-6 days with 0.5mM ethylenediaminetetraacetic acid (EDTA, Invitrogen 15575020) in Dulbecco’s Phosphate-Buffered Saline (DPBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 6% Tris-glycine or NuPAGE 4-12% Bis-Tris gels (Invitrogen; cat# NP0321BOX) and transferred to Immobilon-P PVDF membranes (Millipore Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... 4 and 6 hpi RNA was extracted from cells using TRIzol (Invitrogen; 15596026). RNA was isolated and precipitated following the manufacturer’s institutions and 200ng was reverse transcribed into cDNA using the ABI cDNA synthesis kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Developmental Biology 2019Quote: ... One-third to one embryo equivalents were loaded at per lane on 4%-12% or 8% Bolt® Bis-Tris (Invitrogen). GFP Rabbit IgG Polyclonal Antibody (Molecular Probes ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Immunology 2022Quote: ... containing 4′,6-diamidino- 2-phenylindole (DAPI) and were transferred onto microscope slides with large-orifice 200 µL-tips (Fisher Scientific, 02707134). The following antibodies or reagents were used ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) as counterstaining.
-
bioRxiv - Cell Biology 2021Quote: ... cells were washed three times with PBS and mounted on the slide with ProLong Diamond antifade with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies, #P36966). Confocal images were acquired on a Nikon Ti-Eclipse A1M microscope fitted with a 60× oil immersion objective using 488 nm ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were washed three times and ProLong® Gold Antifade mounting reagent containing DAPI (4’,6-diamidino-2-phenylindole) (Thermo Scientific, #P10144) was applied to mount the coverslips.
-
bioRxiv - Microbiology 2021Quote: ... then 50 μl of the EV preparations were mixed with 250 μl PBS staining buffer containing 2.5 µg/ml DAPI (4’, 6-diamidino-2-phenylindole; Thermo Fisher Scientific, USA)) and kept at 4 °C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were again washed and incubated for 10 min in a solution of 4’,6’-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific). Cells were imaged using a Leica DM IRB epifluorescence microscope ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... sections were rinsed three times for 10 min each and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4′,6-diamidino-2-phenylindole (DAPI) (00-4959-52, Invitrogen, Thermo Fisher Scientific) as counterstaining.
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were counterstained with 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI) and appropriate secondary antibodies conjugated to fluorochromes (Thermo Fisher Scientific) were applied for 1 hour at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... Isolated B cells were stained for 20 minutes on ice with a fluorescence staining-mix containing 4’,6-Diamidin-2-phenylindol (DAPI; Thermo Fisher Scientific), anti-human CD20-Alexa Fluor 700 (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... Alexa-Fluor 594 labelled goat anti-rabbit IgG, ProLong Gold antifade reagent with DAPI (4’, 6-diamidino-2-phenylindole) (Life technologies-Invitrogen, USA), ATP Affinity kit (no ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with DAPI (4’,6-diamidino-2-phenylindole) and filamentous actin with Alexa Fluor 488-conjugated phalloidin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... The coverslips were then washed with 1x PBS and incubated with μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies, #D1306), followed by mounting as described above.
-
bioRxiv - Immunology 2022Quote: ... Cells were then washed with DPBS before being stained with 50 μL/well of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) (Invitrogen, cat. #D1306) diluted to 5 μM in DPBS for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... After 2 washes with 1xPBS, the cell nuclei were stained with NucBlue Fixed Cell Stain ReadyProbes Reagent (4’,6-diamidino-2-phenylindole, DAPI) (Thermo Fisher Scientific) for 30 min in the dark at RT ...
-
bioRxiv - Physiology 2023Quote: ... the coverslips were washed with PBS three times before being mounted using ProLong™ Diamond Antifade Mountant with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies). Images were obtained with Olympus BX61 fluorescence microscope or Zeiss LSM800 laser confocal scanning microscope and processed using cellSens imaging software (Olympus ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... sections were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min and mounted using SlowFade Diamond Antifade Mountant with DAPI (Invitrogen, Cat# S36964). Slides were imaged using a Nikon Y-FL microscope attached to a Nikon DS-Qi2 camera and images were captured using NIS elements AR software ...
-
bioRxiv - Plant Biology 2023Quote: ... 250 ng/ml 4′,6-diamidino-2′-phenylindole dihydrochloride (DAPI) or 500 nM SYTOX Orange (Life Technologies, Thermo Fisher Scientific, Schwerte, Germany) were used as nucleic acid stain.
-
bioRxiv - Microbiology 2022Quote: ... in PBS prior to staining with DAPI (4=,6-diamidino-2-phenylindole) and mounted in Prolong Diamond antifade (Molecular Probes, Life Technologies). Images were captured using a Nikon Eclipse Ti confocal microscope (Nikon Instruments ...
-
bioRxiv - Microbiology 2023Quote: ... Fixed cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) for visualization of host-cell nuclei and anti-MOMP antibody conjugated to FITC (Thermo Scientific™) for visualization of Chlamydia ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were counterstained with ProLong Gold anti-fade reagent with 4’,6-diami-dino-2-phenylindole (DAPI) (Life Technologies, catalog no. P36935). Images were viewed on a Zeiss Axioskop 2 using AxioVision Rel ...
-
bioRxiv - Physiology 2023Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Bioengineering 2023Quote: ... The slides were thoroughly rinsed and sealed utilizing a SlowFade Gold antifade reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) and coverslips.44 The stained slides were imaged at 4x magnification with an EVOS fluorescence imaging system.
-
bioRxiv - Molecular Biology 2023Quote: ... cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI) (HiMedia) and then observed under the EVOS FL imaging system (Thermo Fisher Scientific) using both DAPI and GFP channels ...
-
bioRxiv - Neuroscience 2024Quote: ... Sciatic nerves of 6 mouse pups between postnatal days 2 and 4 (P2 and P4) were collected in L15 medium (Thermofisher, Massachusetts, USA) and incubated for 30 min in 2 mg/mL collagenase II and then 10 min in 0.25 % trypsin containing EDTA at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: RNA was isolated from the aqueous phase of homogenized spleens mixed with 1-bromo-3-chloropropane and purified with the PureLink RNA kit (Invitrogen) separately ...
-
bioRxiv - Cell Biology 2019Quote: ... or 4 mL diamidino-2-phenylindole (DAPI; Thermo Scientific, 62248) in DPBS at a 1:1000 concentration ...
-
bioRxiv - Cancer Biology 2020Quote: 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein Diacetate (DAF) (ThermoFisher) was used to measure and spatially resolve nitric oxide (NO ...
-
bioRxiv - Neuroscience 2021Quote: ... 2) Bolt 4-12% Bis-Tris Plus Gels (Invitrogen NW04120BOX); 3 ...
-
bioRxiv - Immunology 2022Quote: ... sodium pyruvate (2□mM) and L-glutamine (4□mM) (Gibco), pH 7.4 at 37□°C ...
-
bioRxiv - Immunology 2023Quote: ... sodium pyruvate (2 mM) and L-glutamine (4 mM) (Gibco), pH 7.4 at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... and snap frozen in 2-methylbutane (Fisher Scientific, O3551-4) before being transferred to a -80°C freezer for storage ...
-
bioRxiv - Genetics 2023Quote: ... we added 2 mL of 4% PFA (cat#28906 Thermofisher) in PBS (cat#10010-023 Gibco ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...
-
bioRxiv - Bioengineering 2023Quote: ... HA-tetrazine was synthesized as described previously using 79 kDa HA with molar equivalents of 1:1:0.25 of HA-repeat units to 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM) (Thermo Fisher Scientific) to tetrazine-amine (Chem-Impex).[16] 1H NMR shifts of pendant tetrazine groups at δ8.5 (2H ...