Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for 6 BROMO 2 4 CHLOROPHENYL 3 METHYLQUINOLINE 4 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Cell Biology 2020Quote: ... and then loaded with fluorescent Ca2+ probes (3 μM of fura-2 AM or 5.69 μM of Fluo-4 AM, Life Technologies) in HBSS for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... third instar larvae were dissected in zero Ca2+ HL-3 solution at room temperature and stimulated with a HL-3 solution of 90 mM K+/2 mM Ca2+/4 μM FM4-64 (Invitrogen) for 5 min to load FM4-64 dye into the boutons ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were treated with RNAScope H2O2 for 4 min at RT and subsequently washed 2 x 3 min with UltraPure Distilled Water (Invitrogen) at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... ionomycin (1 μg/ml) and monensin (2 μg/ml) for 3-4 hours at 37°C in complete IMDM medium (Gibco). Viability staining was performed using the fixable viability dye eFluor780 ...
-
bioRxiv - Developmental Biology 2021Quote: ... were crossed for 2-3 days and then transferred to fly food made from 0.6 g of Carolina Formula 4-24 (Fisher Scientific) and 2 mL of ddH2O ...
-
bioRxiv - Biophysics 2022Quote: ... N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (NBD-PE) was purchased from ThermoFisher (Waltham, MA). Cholesterol Oxidase from Streptomyces was purchased from MP Biomedicals (Santa Ana ...
-
bioRxiv - Neuroscience 2023Quote: ... Media was partially renewed every 3-4 days with neuronal differentiation media 2 (NDM2: 1:1 DMEM/F12:NB (Gibco), glutamax (Gibco) ...
-
bioRxiv - Genomics 2024Quote: ... and transfer plasmids were transfected at a mass ratio of 2:3:4 with Lipofectamine 3000 (Thermo Fisher Scientific L3000001) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: SMGs were fixed for 6-8 hours in 4% paraformaldehyde (PFA; Thermo Scientific) at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 6% Tris-glycine or NuPAGE 4-12% Bis-Tris gels (Invitrogen; cat# NP0321BOX) and transferred to Immobilon-P PVDF membranes (Millipore Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... 4 and 6 hpi RNA was extracted from cells using TRIzol (Invitrogen; 15596026). RNA was isolated and precipitated following the manufacturer’s institutions and 200ng was reverse transcribed into cDNA using the ABI cDNA synthesis kit (Applied Biosystems ...
-
bioRxiv - Bioengineering 2022Quote: ... is purchased from MakingCosmetics Inc. (USA). 4- (2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1M solution, Cat. No. J16924-AP) is purchased from Thermo Scientific (USA). Silica beads (Cat ...
-
bioRxiv - Systems Biology 2023Quote: Samples were resuspended in 4% formic acid/2% acetonitrile solution and analyzed on an Q-Exactive Plus MS system (Thermo Fisher Scientific) equipped with an Easy nLC 1200 ultra-high pressure liquid chromatography system (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAB-developed samples were stored in 70% glycerol and counterstained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, #D3571, 1:1000) nuclear marker ...
-
bioRxiv - Immunology 2022Quote: ... containing 4′,6-diamidino- 2-phenylindole (DAPI) and were transferred onto microscope slides with large-orifice 200 µL-tips (Fisher Scientific, 02707134). The following antibodies or reagents were used ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were then washed as above and incubated in 1 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) at RT for 10 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DAPI (4-6-diamidino-2-phenylindole) and DyLight 488-or DyLight 555-labeled secondary antibodies (1:400, Thermo Fisher Scientific, Waltham, MA) were added for 1.5h at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Slides were subsequently rinsed in PBS and counterstained with 1:5000 dilution of DAPI (4′,6-Diamidino-2-phenylindole dihydrochloride, Invitrogen, Eugene, OR) in deionized water for 3-5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) as counterstaining.
-
bioRxiv - Cell Biology 2021Quote: ... cells were washed three times with PBS and mounted on the slide with ProLong Diamond antifade with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies, #P36966). Confocal images were acquired on a Nikon Ti-Eclipse A1M microscope fitted with a 60× oil immersion objective using 488 nm ...
-
bioRxiv - Bioengineering 2022Quote: ... D13+14 PT-enhanced organoids (triplicate wells per condition) were incubated in 4’,6-diamindino-2-phenylindole substrate (DAPI; 1:1000 [Thermo Fisher Scientific]) with 1:500 DRAQ7 dead cell label (Thermo Fisher Scientific] ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were washed three times and ProLong® Gold Antifade mounting reagent containing DAPI (4’,6-diamidino-2-phenylindole) (Thermo Scientific, #P10144) was applied to mount the coverslips.
-
bioRxiv - Microbiology 2021Quote: ... then 50 μl of the EV preparations were mixed with 250 μl PBS staining buffer containing 2.5 µg/ml DAPI (4’, 6-diamidino-2-phenylindole; Thermo Fisher Scientific, USA)) and kept at 4 °C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were again washed and incubated for 10 min in a solution of 4’,6’-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific). Cells were imaged using a Leica DM IRB epifluorescence microscope ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... sections were rinsed three times for 10 min each and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4′,6-diamidino-2-phenylindole (DAPI) (00-4959-52, Invitrogen, Thermo Fisher Scientific) as counterstaining.
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were counterstained with 2-(4-Amidinophenyl)-1H-indole-6-carboxamidine (DAPI) and appropriate secondary antibodies conjugated to fluorochromes (Thermo Fisher Scientific) were applied for 1 hour at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... Isolated B cells were stained for 20 minutes on ice with a fluorescence staining-mix containing 4’,6-Diamidin-2-phenylindol (DAPI; Thermo Fisher Scientific), anti-human CD20-Alexa Fluor 700 (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... Alexa-Fluor 594 labelled goat anti-rabbit IgG, ProLong Gold antifade reagent with DAPI (4’, 6-diamidino-2-phenylindole) (Life technologies-Invitrogen, USA), ATP Affinity kit (no ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with DAPI (4’,6-diamidino-2-phenylindole) and filamentous actin with Alexa Fluor 488-conjugated phalloidin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... cells were labeled with DAPI together with the secondary antibody (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10.000, Thermo Fisher Scientific, #D1306). The following secondary antibodies were used ...
-
bioRxiv - Cell Biology 2022Quote: ... The coverslips were then washed with 1x PBS and incubated with μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies, #D1306), followed by mounting as described above.
-
bioRxiv - Immunology 2022Quote: ... Cells were then washed with DPBS before being stained with 50 μL/well of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) (Invitrogen, cat. #D1306) diluted to 5 μM in DPBS for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... After 2 washes with 1xPBS, the cell nuclei were stained with NucBlue Fixed Cell Stain ReadyProbes Reagent (4’,6-diamidino-2-phenylindole, DAPI) (Thermo Fisher Scientific) for 30 min in the dark at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... sections were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min and mounted using SlowFade Diamond Antifade Mountant with DAPI (Invitrogen, Cat# S36964). Slides were imaged using a Nikon Y-FL microscope attached to a Nikon DS-Qi2 camera and images were captured using NIS elements AR software ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Physiology 2023Quote: ... the coverslips were washed with PBS three times before being mounted using ProLong™ Diamond Antifade Mountant with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies). Images were obtained with Olympus BX61 fluorescence microscope or Zeiss LSM800 laser confocal scanning microscope and processed using cellSens imaging software (Olympus ...
-
bioRxiv - Plant Biology 2023Quote: ... 250 ng/ml 4′,6-diamidino-2′-phenylindole dihydrochloride (DAPI) or 500 nM SYTOX Orange (Life Technologies, Thermo Fisher Scientific, Schwerte, Germany) were used as nucleic acid stain.
-
bioRxiv - Microbiology 2022Quote: ... in PBS prior to staining with DAPI (4=,6-diamidino-2-phenylindole) and mounted in Prolong Diamond antifade (Molecular Probes, Life Technologies). Images were captured using a Nikon Eclipse Ti confocal microscope (Nikon Instruments ...
-
bioRxiv - Microbiology 2023Quote: ... Fixed cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) for visualization of host-cell nuclei and anti-MOMP antibody conjugated to FITC (Thermo Scientific™) for visualization of Chlamydia ...
-
bioRxiv - Zoology 2023Quote: ... stained with 4′,6-diamidino-2-phenylindole (DAPI) (1:2000 dilution) and Alexa Fluor-conjugated donkey-anti-mouse (Molecular Probes, 1:1000), in PBST at room temperature for 2 hours ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were counterstained with ProLong Gold anti-fade reagent with 4’,6-diami-dino-2-phenylindole (DAPI) (Life Technologies, catalog no. P36935). Images were viewed on a Zeiss Axioskop 2 using AxioVision Rel ...
-
bioRxiv - Physiology 2023Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Zoology 2024Quote: ... Tissue samples were subsequently rinsed three times with DPBS again and then transferred onto microscope slides in mounting buffer containing 1:1 DPBS: glycerol and 1µg/mL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Molecular Probes, Eugene, OR) to stain cell nuclei in prepared tissues and examined under a Lumen Dynamics XCite™ 120Q Nikon fluorescence microscope (Nikon ...
-
bioRxiv - Bioengineering 2023Quote: ... The slides were thoroughly rinsed and sealed utilizing a SlowFade Gold antifade reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) and coverslips.44 The stained slides were imaged at 4x magnification with an EVOS fluorescence imaging system.
-
bioRxiv - Molecular Biology 2023Quote: ... cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI) (HiMedia) and then observed under the EVOS FL imaging system (Thermo Fisher Scientific) using both DAPI and GFP channels ...
-
bioRxiv - Neuroscience 2024Quote: ... Sciatic nerves of 6 mouse pups between postnatal days 2 and 4 (P2 and P4) were collected in L15 medium (Thermofisher, Massachusetts, USA) and incubated for 30 min in 2 mg/mL collagenase II and then 10 min in 0.25 % trypsin containing EDTA at 37 °C ...