Labshake search
Citations for Thermo Fisher :
9401 - 9450 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... The plates were sealed with a MicroAmp film Translucent gas-tight (Applied Biosystems), and growth was assessed by measuring OD600 using a microplate reader (SpectraMax Plus 384) ...
-
bioRxiv - Systems Biology 2024Quote: ... EBs were plated on gelatin-coated 6-well plates in DMEM medium (GIBCO) supplemented with 20% (vol/vol ...
-
bioRxiv - Bioengineering 2023Quote: DNA assay kit QuantiT dsDNA HS kit (Invitrogen) was used to quantify the DNA content from cell lysate according to the manufacturers protocol ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... PCR generated amplicon libraries were obtained from 100 ng faecal DNA using the ITS1 primer set containing an overhang for the Illumina Nextera platform [forward] 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTTGGTCATTTAGAGGAAGTAA and [reverse] 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTGCGTTCTTCATCGATGC primers and Phusion High Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA). A duplicate reaction in 20 μl was performed with following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The tryptic peptides were loaded at 5 μL/min onto a C18 trap column (Thermo Scientific, 100 µm ID×2 cm, 5 μm, 120 Å). Peptides were separated with PicoFrit columns (New Objective ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Biochemistry 2022Quote: ... in HPLC grade H2O) on a trapping column (Acclaim PepMap μ-precolumn, C18, 300 μm × 5 mm, 5 μm, 100 Ǻ, Thermo Scientific, Bremen, Germany). After sample loading ...
-
bioRxiv - Microbiology 2021Quote: ... membrane pellets were gently resuspended in 6 ml of resuspension buffer (25% [wt/wt] sucrose, 5 mM Tris, 30 mM MgCl2, 1 tablet of Pierce Protease Inhibitor Mini Tablets, EDTA-Free [Thermo Scientific], 5 U Benzonase [Novagen]), suspensions were incubated with gentle mixing for 30 min at room temperature to degrade DNA ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR reactions were carried out in 10 µL volumes using 5 ng of total template using PowerUp Syber Green Master) in a QuantStudio 5 Real-Time PCR System Mix (Applied Biosystems, Foster City, CA, USA).
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Immunology 2020Quote: ... Samples were injected on to a μ-Precolumn™ Cartridge (Acclaim PepMap100 C18, 5 μm, 100 Å, 300 μm ID x 5 mm from Thermo Fisher Scientific) and peptides resolved on an 360 μm OD x 100 μm ID fused silica tip packed with 12cm of Aeris Peptide 3.6 μm XB-C18 100Å material (Phenomenex ...
-
bioRxiv - Biochemistry 2023Quote: ... and blotted for 5 s with a blot force of 5 at ∼90% humidity and 8°C using a Vitrobot Mark IV (Thermo Fisher Scientific Inc., Waltham, USA) that was placed inside an anaerobic COY tent ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Cell Biology 2023Quote: ... following kit instructions (BCA Protein Assay kit, ThermoFisher #23225) and 20µg loaded into each well of a NuPAGE 4-12% Bis-Tris Gel (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Genomics 2019Quote: ... Two-colour FISH was performed by labelling 100 ng for each BAC clones with alexa fluorochromes (ChromaTide® Alexa Fluor® 488-5-dUTP, Molecular probes; ChromaTide® Alexa Fluor® 568-5-dUTP, Molecular Probes) by random priming using the Bioprim Kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 x 10 ^5 TC32 or A673 cells (mixed in a 1:1 solution of growth factor reduced Geltrex [Life Technologies, catalog number A1413202] with PBS) were injected into the mouse in a peritibial location.
-
bioRxiv - Synthetic Biology 2021Quote: ... All luciferase assays were conducted in LumiNunc 96-well white plates (Thermo Scientific, #136101). NanoLuc luciferase was normalized by constitutively expressed firefly luciferase.
-
bioRxiv - Biophysics 2019Quote: ... Reactions were performed in triplicate in a 384 well optical plate (Thermo Scientific Nunc). The plate was detected by a Varioskan® Flash microplate reader (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were run on a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher), and data were analyzed using the comparative CT method to generate expression fold-change values ...
-
bioRxiv - Cell Biology 2020Quote: ... The culture plate was then put into a microplate reader (Thermo Scientific, Multiskan GO) for inspection of the absorbance value at 450 nm and this optical density (OD ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transiently transfected in 6-well plates with Lipofectamine 2000 (Life Technologies), as per the manufacturer’s instructions ...
-
SIRT1 ameliorates premature senescence-induced defenestration in hepatic sinusoidal endothelial cellbioRxiv - Cell Biology 2020Quote: ... Primary rat HSECs were cultured in plates with medium comprising 80% MCDB131 (Gibco, 10372019) and 20% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... MEF plates were used within 1 week and washed with DPBS (ThermoFisher Scientific 14190250) prior to plating of ESC/D-EPSCs in appropriate media.
-
bioRxiv - Cell Biology 2020Quote: ... 10,000 TZM-bl cells per well were seeded in 96-well plates (Nunc-Greiner). The following day cells were infected with an equal volume of culture supernatant for 4 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were seeded in transparent tissue-culture 96-well plates (Sarstedt, Thermo Fisher Scientific) and allowed to adhere overnight ...
-
bioRxiv - Immunology 2021Quote: ... plates were washed and developed with streptavidin-HRP (1:1000; ThermoFisher Scientific, Pittsburgh, PA) and TMB ...
-
bioRxiv - Immunology 2021Quote: Macrophages generated as above were harvested from plates using Trypsin-EDTA (Thermo fisher scientific). The indicated target cells were labeled with Celltrace violet (Thermo fisher scientific ...
-
bioRxiv - Immunology 2021Quote: ... All qPCRs were performed in MicroAmp Fast Optical 96 WellReaction Plates (Thermo Fisher Scientific) using AppliedBiosystems 7500 Fast Real-Time PCR System with 7500Software V2.0.6 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Plates were washed three times with PBS-Tween 20 (Fisher Scientific, Cat. #BP337-500), then blocked with 5% w/v non-fat dry milk (Nestle Carnation ...
-
bioRxiv - Developmental Biology 2021Quote: Cells were detached from cell culture plates by incubation with 0.25% trypsin-EDTA (Invitrogen) plus 2% chick serum (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plates were washed and free binding sites were then blocked with Superblock (Thermofisher Scientific) at room temperature for 30 min and then incubated with serial dilutions (200- to 12800-fold for serum ...
-
bioRxiv - Developmental Biology 2021Quote: ... the plates were sealed with MicroAmp Optical Adhesive Film (Thermofisher, cat#: 43-119-71) and allowed to incubate at RT in the dark for at least 15min to rehydrate primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCRs were performed in 96-well plates on ABI Prism 7500 (Applied Biosystems) using SYBR Green according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... plating on BHI agar plates containing 10 μg mL−1 erythromycin (Erm; Fisher Scientific). A gene SOEing product merging the two flanking regions of relP was then generated ...
-
bioRxiv - Neuroscience 2021Quote: ... The resulting peptides were desalted with the 10 mg SOLA C18 Plates (Thermo Scientific), dried ...
-
bioRxiv - Neuroscience 2021Quote: ... plate in 100uL of complete microglia media (High glucose DMEM (Fisher scientific 10313-021) + 1x L-Glutamine (Millipore TMS-002-C ...
-
bioRxiv - Neuroscience 2021Quote: Five-million primary microglial cells were cultured in 60 mm diameter plates (Nunclon, ThermoFisher) and exposed to OND in a hypoxia chamber (1% O2 ...
-
bioRxiv - Immunology 2020Quote: ... cells were stimulated with 1 µg/mL plate bound anti-CD3 (UCHT1, Thermo Fisher Scientific Cat# 16-0038-85 ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein adsorbing 384-well microtiter plates (Nunc® MaxisorpTM, ThermoFisher Scientific, Waltham, MA, USA) were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the plate was sealed with MicroAmp® Optical Adhesive Film (Thermo Fisher Scientific). Fluorescence intensity was measured using 580 nm excitation and 623 nm emission filters ...
-
bioRxiv - Molecular Biology 2021Quote: ... LentiX and PlatE packaging cells were maintained in DMEM medium with 10% FBS (Invitrogen) and Penicillin/Streptomycin (Invitrogen).
-
bioRxiv - Molecular Biology 2021Quote: ... inter-plate QC) were run in triplicate with SYBR Green Master Mix (Applied Biosystems) on a ViiA 7 Real-time PCR System (Applied Biosystems) ...
-
bioRxiv - Bioengineering 2022Quote: ... and culturing in 24-well plates (Polystyrene, Nunc, Non-Treated Multidishes, Thermo Fisher Scientific) at 37°C in the organoid expansion media ...
-
bioRxiv - Cell Biology 2022Quote: Cell transfections were performed in 6-well plates using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... cells were lysed directly in the plate by adding 1 ml of Trizol (Invitrogen). RNA was isolated using the Direct-Zol RNA Miniprep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2020Quote: ... the plates were blocked for 1 h at room temperature using StartingBlock (Thermo scientific) to avoid non-specific binding ...