Labshake search
Citations for Thermo Fisher :
9201 - 9250 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was synthesized from 500 ng total RNA in 10 μl reactions using Superscript VILO cDNA synthesis kit (Invitrogen) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was eluted with 30 µL 1x TE buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 7.5) twice followed by TURBO DNA-free kit (ThermoFisher, AM1907) treatment at 37 °C for 20 min ...
-
bioRxiv - Physiology 2023Quote: ... RNA samples (10 µg of each) were subjected to DNase treatment using a Turbo DNA-free kit (Invitrogen, USA). RNA concentrations and quality were determined using a Nanodrop® ND1000 spectrophotometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein concentrations of cell lysates were measured after centrifugation at 20,817g for 10 minutes at 4 °C using a Micro BCA Protein Assay Kit (Invitrogen). 50 μg of total proteins were analyzed by SDS-PAGE and Western blotting ...
-
bioRxiv - Molecular Biology 2024Quote: Gene disruption by CRISPR-Cas9 ribonucleoprotein (RNP) was performed with the NeonTM Transfection System 10 μL kit (ThermoFisher #MPK1025) as described previously(67 ...
-
bioRxiv - Cancer Biology 2024Quote: A protein assay was performed on 10 µL of cell lysate using Pierce BCA Protein Assay Kit (23225, Thermofisher) and following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribonucleoprotein complexes consisting of 200 pmol sgRNA (Synthego, CRISPRevolution sgRNA EZ kit) and 10 μg Cas9 (Thermo Fisher, A36499) were prepared in electroporation buffer to a final volume of 25 μL per sample ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was extracted from pools of 10 female mosquitoes using the Arcturus PicoPure RNA Isolation Kit (Life Technologies) as described previously [17 ...
-
bioRxiv - Bioengineering 2023Quote: ... then fixed in 10% formalin for immunohistochemical evaluation using the Click-iT™ EdU Cell Proliferation Kit (C10634, ThermoFisher) per manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... Samples were subject to C18 Clean up (Waters) and labelling with 10 plex Tandem Mass Tagging Kit (ThermoFisher Scientific) following manufacturers protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... 801–1(10 KU)] kit and the qPCR using the SYBR™ Fast Green Master mix (Thermo Fisher, 4385612).
-
bioRxiv - Immunology 2023Quote: ... LLC) were electroporated into Raji and OCI-Ly8 cells using the Neon™ Transfection System 10 μL Kit (ThermoFisher). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBST (3x for 10 min each) and incubated with a Pierce enhanced chemiluminescence kit (Thermofisher) followed by exposure to X-ray film for detection ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 10 ng RNA was reverse-transcribed using Invitrogen Superscript VILO cDNA Synthesis Kit (Thermo Fisher Scientific). Transcriptome libraries were generated using automated library preparation with the Ion AmpliSeq Transcriptome Human Gene Expression Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The reaction mixture was electroporated into cells using NeonTransfection System 10 μL Kit (Thermo Fisher Scientific, Cat. No. MPK1025) with the Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... washed with PBS and resuspended in Resuspension Buffer R (Neon™ Transfection System 10 µL Kit, Cat.# MPK1025, Invitrogen) at a final density of 5.5 × 106 cells/ml ...
-
bioRxiv - Biochemistry 2023Quote: We labeled 10 µg of tryptic peptides from each experiment with a TMT10plex Isobaric Labeling Reagent kit (Thermo Scientific) (Zecha et al. ...
-
bioRxiv - Pathology 2023Quote: ... fixed in 4% paraformaldehyde for 10 min and stained with ALP staining kit (Thermo Fisher Scientific, Rockford, IL, USA) for 15 min.
-
bioRxiv - Molecular Biology 2023Quote: ... 10 µg of RNA was subjected for DNase I treatment using TURBO DNA-freeTM kit (AmbionTM; Thermo Fisher Scientific) according to manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: TMT labeling was performed as instructed by TMT 10-plex Mass Tag Labeling Kits and Reagents (ThermoFisher, Cat# 90110). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids were introduced into U2OS cells by electroporation using the Neon™ Transfection System 10 μL Kit (ThermoFisher Scientific) and cells seeded on eight-well microscopy slides (Ibidi ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% biotinylated dextran amine (BDA 10 kD; D1956, Invitrogen) in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mL of 10% Tween 20 (Fisher Scientific BP337500) and 850 mL ddH2O] under gentle agitation at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µl RNase A (10 mg/ml, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... 10 ng/ml fibroblast growth factor (FGF)-10 (Invitrogen), 100 μM 3-isobutyl-1-methylxanthine (Sigma) ...
-
bioRxiv - Genomics 2023Quote: ... 10% fetal bovine serum (FBS, Gibco 10-082-147), 100 U/mL Penicillin-Streptomycin (Gibco 15140122) ...
-
bioRxiv - Genetics 2022Quote: ... approximately 470 base pairs surrounding the predicted dmiR-1-target site in 3’UTR of Mp were amplified directly from genomic DNA from the w1118 flies using the primers Mp-F1: ATAACTAGTTGAGCGGAAACGGAAGGAAGAAGAGGAG and Mp-R1: ATATCTAGATGTTGTGAATGATGACGTTAGG and a high-fidelity DNA Polymerase enzyme (Thermo Scientific Phusion High-Fidelity DNA Polymerase) kit ...
-
bioRxiv - Plant Biology 2023Quote: ... Target loci were amplified using a proof-reading polymerase (Q5® High-Fidelity DNA Polymerase, New England Biolabs, Ipswich, MA; Phusion™ High-Fidelity DNA Polymerase, Thermo Fisher Scientific, Waltham, USA) and primers flanking the target sites ...
-
bioRxiv - Pathology 2022Quote: RNA extractions of swab material were performed in 96-well plates using Mag Max-96 AI/ND Viral RNA Isolation Kit (Applied Biosystems, Foster City, California) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 25 µl from prepared samples were added to one well of 96 well plate and Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, 23225) manual was followed to measure the protein content ...
-
bioRxiv - Developmental Biology 2023Quote: ... Ovarian cell suspensions were then seeded in 96-well V-bottom plates and incubated with LIVE/DEAD™ Fixable Blue Dead Cell Stain Kit (Invitrogen, L34962, 1:2000) and Fc Block (BioLegend ...
-
bioRxiv - Microbiology 2023Quote: ... then 50 μl of sample or standard was added per well (in duplicate) with premixed beads in a 96-well plate according to the manufacturer instructions (ThermoFisher Procartaplex Human Simplex kit). The plate was incubated overnight on a shaker at 4°C ...
-
bioRxiv - Biophysics 2020Quote: ... 0.02 U/µL Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific) reaction mix (for PCR program details see Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... All cell lines were cultured in high-glucose DMEM (Gibco, 11965092) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... RiboRuler High Range and Low Range RNA ladders (Thermo Fisher Scientific) were marked by UV-shadowing ...
-
bioRxiv - Microbiology 2020Quote: ... GeneRuler High Range DNA ladder (Thermo Scientific™, Cat. No. FERSM1351) was run according to manufacturer instructions with the DNA templates to estimate fragment sizes between 10 and 50 kb.
-
bioRxiv - Molecular Biology 2021Quote: ... were cultured in D-MEM™ (high glucose, Gibco #12440-53) supplemented with 10% FBS (Gibco #10500-64) ...
-
bioRxiv - Developmental Biology 2020Quote: ... were cultured in DMEM High Glucose (41965039, Invitrogen; 10131-027 Invitrogen), supplemented with 10%FBS (10270106 ...
-
bioRxiv - Developmental Biology 2020Quote: ... were cultured in DMEM High Glucose (41965039, Invitrogen; 10131-027 Invitrogen), supplemented with 10%FBS (10270106 ...
-
bioRxiv - Pathology 2022Quote: ... for 20 min at high-pressure or Hotplate (Thermo Fisher, SP88857104) boiling for 20 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Images were acquired using ArrayScan XTI high-resolution camera (Thermo Fisher).
-
bioRxiv - Molecular Biology 2021Quote: ... and we used Phusion High-Fidelity DNA Polymerase (Thermo Scientific, F530L) instead of Phusion polymerase (NEB ...
-
bioRxiv - Cell Biology 2022Quote: HEK293T (293T) were cultured in DMEM High-Glucose (Thermo Fisher, 11965084) with 10% FBS and 1% penicillin–streptomycin ...
-
bioRxiv - Genomics 2020Quote: ... 1 U of AccuPrime™ Taq DNA Polymerase High Fidelity (Invitrogen), 0.2 µM of each primer and 10-50 ng of template DNA ...
-
bioRxiv - Genomics 2019Quote: Chondrogenic medium was composed of DMEM-high glucose (Thermo Fisher Scientific), 1% penicillin/streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Analysis was carried out on a high-resolution mass spectrometer (ThermoFisher Scientific Exactive Plus MS ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were cultured in high-glucose DMEM (31966-021, Life Technologies) supplemented with 10% fetal bovine serum (10270-106 ...
-
bioRxiv - Neuroscience 2019Quote: Mouse NIH3T3 fibroblasts were grown in DMEM with high glucose (Invitrogen) containing 10% of FBS (HyClone) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 1.0 μL Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Pittsburgh, PA), and 11.6 μL ddH2O ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2U Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific), 0.2 mM dNTP ...