Labshake search
Citations for Thermo Fisher :
9051 - 9100 of 10000+ citations for Recombinant Mouse Il1f6 None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Alexa Fluor 488 goat anti-mouse IgG (Invitrogen A11001, dilution for IF 1:500).
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies include Anti-beta tubulin (1:500, mouse monoclonal, 2 28 33, Invitrogen), Anti-Hec1 (1:1000 ...
-
bioRxiv - Evolutionary Biology 2021Quote: Mouse ESCs were dissociated into single cells using StemPro Accutase (Gibco, Cat. No. A1110501) and five million cells were transfected using program A-023 according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... Secondary antibodies used are anti-mouse horseradish peroxidase (HRP) (1:5000, Cat #31430, Invitrogen) and anti-rabbit HRP (1:10000 ...
-
bioRxiv - Cell Biology 2021Quote: ... hippocampi were dissected from E18 mouse embryos and they were washed with HBSS (Invitrogen). Hippocampi were digested by 0.025% trypsin (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunofluorescence wwas performed as previously described using a mouse anti-IdU antibody (Invitrogen, MD5000) (Lorvellec et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Goat Anti-Mouse Alexa Fluor® 488 antibody (8 μg/ml, A-11029 Invitrogen), Goat anti Rabbit Alexa Fluor® 568 antibody (8 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary antibodies used were Alexa 488–labeled goat anti-mouse IgG from Life Technologies and Cy3-labeled goat anti-mouse IgG from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Cell Biology 2020Quote: ... Anti-mouse and anti-rabbit HRP-conjugated secondary antibodies were purchased from Thermo Scientific and used at concentrations 1:10.000-1:50.000 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Alexa Fluor® 647 goat anti-mouse (Thermo Fisher, Cat. No. A 21235).
-
bioRxiv - Immunology 2020Quote: ... samples were incubated with anti-Mouse Alexa 350 (Molecular Probes, Thermo Scientific, 1:250) in blocking solution for 2 hours ...
-
bioRxiv - Immunology 2020Quote: ... samples were incubated with anti-Mouse Alexa 350 (Molecular Probes, Thermo Scientific, 1:250) in blocking solution for 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... Wells were then incubated with 25 µg/mL natural mouse laminin (Gibco #23017-015) diluted in sterile MQ water overnight at 4°C and removed immediately preceding cell plating ...
-
bioRxiv - Genetics 2021Quote: ... were coupled to Dynabeads coated with Pan Mouse IgG antibodies (Thermo Fisher Scientific, 11042). ChIP-seq libraries were prepared as described [60] and sequenced for 50 cycles in paired-end mode on the Illumina HiSeq 4000 platform at the McGill University and Génome Québec Innovation Centre.
-
bioRxiv - Microbiology 2021Quote: ... For samples that were mixed with protein (BSA, human CAR, mouse CAR [Fisher Scientific]) prior to attachment ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1:500 Donkey anti-mouse ALEXA 594 for Ki67 (Invitrogen, Burlington, ON, Canada), 1% NDS ...
-
bioRxiv - Microbiology 2021Quote: ... followed by staining with Alexa Fluor 488-conjugated goat anti-mouse secondary antibody (Invitrogen).
-
bioRxiv - Evolutionary Biology 2021Quote: ... and Alexa fluor 594-conjugated goat anti-mouse antibody (A11005; Invitrogen; dilution 1:1000). Nuclei were stained using Hoechst 33342 (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... primary antibody used was mouse anti-HuC/D (1:500; 16A11, Molecular Probes, USA), which was detected using Alexa Fluor 555 conjugated goat anti-mouse IgG diluted 1/1000 ...
-
bioRxiv - Microbiology 2020Quote: ... BMDMs were collected from mouse femurs and differentiated in RPMI 1640 medium (Thermo Fisher) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... Alexa Fluor™ 594-conjugated goat anti-mouse IgM and IgG (Thermo Fisher Scientific), FITC-conjugated goat anti-rabbit IgG (MP Biomedicals ...
-
bioRxiv - Microbiology 2020Quote: ... The proteins were analyzed on an immunoblot probed with mouse anti-6XHis antibody (Invitrogen) and horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG secondary antibody (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... containing a guide RNA targeting mouse CD81 (GCAACCACAGAGCTACACCT) using Lipofectamine 2000 (11668027, Life Technologies). Puromycin selection was carried out 36 hours after transfection using a 5 μg/ml solution ...
-
bioRxiv - Immunology 2021Quote: ... 48h and labelled with 4 ng μL−1 mouse V5 specific primary antibody (Invitrogen) followed by 4 ng μL−1 goat-anti-mouse-AF488 (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... The mice were intravenously injected with 20μg of eFluor450 anti-mouse CD31(390, Invitrogen), and with 25μg Manocept-Cy5 or -Alexa488 to visualize dermal TRMs ...
-
bioRxiv - Molecular Biology 2021Quote: ... Alexa fluor 568 goat anti-mouse IgG1 (Invitrogen, cat# A-21124; 1/1000 dilution), and Alexa fluor 488 goat anti-rabbit IgG (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: Melan-ink4a mouse melanocytes were cultured in RPMI-1640 (Gibco, Grand Island, New York) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... The V5 epitope tag was detected by using mouse monoclonal anti-V5 antibody (Invitrogen) at 1 ug/ml ...
-
bioRxiv - Immunology 2021Quote: ... followed by Alexa Fluor Plus 488-conjugated anti mouse IgG antibody (Invitrogen, 1:800).
-
bioRxiv - Immunology 2021Quote: ... and T-cell markers mouse anti-human CD3 (Thermo Fisher Scientific, 11-0037-41) and mouse anti-human CD4 (Tonbo Biosciences ...
-
bioRxiv - Immunology 2020Quote: ... Tregs were stimulated using CD3/CD28 Mouse T-Activator Dynabeads (Thermo Fisher, Cat# 11456D) at a ratio of 3:1 beads to cells for 48 hours ...
-
bioRxiv - Microbiology 2021Quote: ... incubated with anti-mouse IgG-horseradish peroxidase (IgG-HRP) conjugate (1:5000 dilution, Invitrogen), and developed with ProSignal™ Pico Spray (Prometheus) ...
-
Preferred endocytosis of amyloid precursor protein from cholesterol-enriched lipid raft microdomainsbioRxiv - Neuroscience 2020Quote: ... cells were incubated with goat anti-mouse conjugated with Alexa Fluor 568 (Invitrogen, #A11004) and donkey anti-rabbit conjugated with Alexa Fluor 647 in blocking buffer overnight to detect primary antibodies 6E10 and α-NeuN ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse liver and cell lines were exptracted using the TRIzolTM reagent (15596018, Invitrogen, USA), and reverse transcribed into complementary DNA using Evo M-MLV RT Premix for qPCR (AG11706 ...
-
Myosin VI regulates ciliogenesis by promoting the turnover of the centrosomal/satellite protein OFD1bioRxiv - Cell Biology 2021Quote: ... Primary antibodies used for PLA include mouse anti-GFP (1:2000; ThermoFisher Scientific, A11120) and rabbit anti-OFD1 (1:2000 ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-mouse Alexa Fluor 488-conjugated secondary antibody (1:200, 1h, Invitrogen #A21235), phalloidin Texas red (1:100 ...
-
bioRxiv - Genomics 2021Quote: ... and secondary antibody goat anti-mouse 488 (ThermoFisher, catalog # A11001, and 1:500 dilution), and counter stained in 1 μg/ml DAPI ...
-
bioRxiv - Genetics 2019Quote: ... and 1:100 of Goat anti-Mouse IgG-Alexa Fluor 405 (A31553, Thermo Fisher) for one hour on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibodies at 1:200: Alexa Fluor® 555 donkey anti-mouse (Thermo Fisher Scientific Cat# A-31570 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mouse secondary antibody conjugated with Alexa flour-488 (Invitrogen, cat no A-11001), Goat anti-rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2021Quote: OP9 mouse stromal cells (ATCC-CRL-2749) were maintained in α-MEM (Life Technologies) with 20% FBS (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... myoblasts were labeled with anti-CD56/NCAM (mouse clone Eric-1; Thermo Fisher Scientific), followed by magnetic bead–labeled secondary antibodies and subsequently separated by magnets (Dynal/Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... The following antibodies were used: anti-mouse NF-κB p65 (Invitrogen, 14-6731-81); anti-mouse Phospho-NF-κB p65 (Ser536 ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Alexa Fluor 568–conjugated goat anti-mouse (1:1000; A11004; Thermo Fisher Scientific). Alexa Fluor 488–conjugated streptavidin (S32354 ...
-
bioRxiv - Biophysics 2020Quote: ... Alexa Fluor® 546 Goat Anti-Mouse(1:5000, Thermo Fisher Scientific A-11030), Alexa Fluor® 546 Goat Anti-Rabbit (1:5000 ...
-
bioRxiv - Cell Biology 2021Quote: ... consisting of 1:1000 (v/v) goat anti-mouse AlexaFluor 647 (Invitrogen A-21236) and 3 μg/mL Hoechst 33342 dye in blocking buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Secondary antibodies anti-human-HRP and goat anti-mouse-HRP were purchased from Thermofisher Scientific and Vector Labs ...
-
bioRxiv - Neuroscience 2020Quote: ... AlexaFluor-488 (1:500; goat anti-rabbit, goat anti-chicken, goat anti-mouse; Invitrogen), AlexaFluor-568 (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... and incubated with secondary α-mouse antibody conjugated to Alexa Fluor 488 (Invitrogen, A11029) for 30 minutes at RT followed by a 5-minute incubation with 300 nM 4′,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated o/n with either 1:1000 mouse anti-GFP (Invitrogen, Ref: A22230) or 1:1000 rabbit anti-RFP (Rockland ...