Labshake search
Citations for Thermo Fisher :
851 - 900 of 10000+ citations for Recombinant Human Lectin Galactoside Binding Soluble 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... a rabbit polyclonal antibody specific to soluble tachyzoite antigen (STAG) directly conjugated to FITC (PA1-7253, Invitrogen) was diluted 1:300 in TBS-T (0.1% Tween20 ...
-
bioRxiv - Neuroscience 2021Quote: ... Soluble supernatant fractions were collected and protein concentration was determined by the Pierce BCA assay (Thermo Scientific). 20µg of protein from all samples were used for immunoblotting.
-
bioRxiv - Neuroscience 2020Quote: ... 500 µg of the soluble protein extract was incubated with 30 µl Dynal magnetic beads (Invitrogen, 110.31) coated with 1 µg of required antibodies and washed from excess antibody ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein concentrations of the soluble fraction were determined by the BCA assay (Thermo Fisher Scientific, Cat # 23227). To remove carryovers ...
-
bioRxiv - Genomics 2023Quote: Quantitative measurement of water-soluble protein performed using Pierce BCA Protein Assay Kit (Thermo Scientific, Rockford, IL) [26] ...
-
bioRxiv - Cancer Biology 2021Quote: ... human (Invitrogen). Cells were cultured in DMEM (Corning Cellgro 10-013-CV ...
-
Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosomebioRxiv - Cell Biology 2020Quote: ... elegans γ-tubulin were cloned into human expression vectors driven by the CMV promoter (Table 3) and co-transfected into FreeStyle 293-F cells (Thermo Fisher Scientific). The empty 5Myc plasmid (CS2P ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Calu-3 (human, Caucasian, lung, adenocarcinoma) cell line was obtained from ATCC and maintained in Minimum Essential Medium (MEM; Gibco, Thermo-Fisher) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... synthesized to knockdown human GJA1 mRNA (sequence 5’ to 3’: GGGAGAUGAGCAGUCUGCCUUUCGU; cat. # HSS178257) and Stealth™ RNAi (Thermo Fisher scientific, cat. # 12935112) was used as a negative control ...
-
bioRxiv - Physiology 2020Quote: ... and PCR was performed on the QuantStudio 6 Flex system (3 technical replicates per mouse, Applied Biosystems, Iowa Institute of Human Genetics). Gene expression was calculated using the ΔΔct method (39 ...
-
bioRxiv - Genomics 2021Quote: Human brain tissues were manually dissected into small 2-3 mm3 pieces and immersed in homogenization buffer (HBSS (Life Technologies, 14175-095), 1% bovine serum albumin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... 11D5-3 single chain variable fragment (scFv)3 and the human heavy-chain-only FHVH3316 were codon-optimized and synthesized by GeneArt (Thermo Fisher Scientific). Retroviral constructs encoding APRIL CARs ...
-
bioRxiv - Molecular Biology 2022Quote: Keratinocytes were transfected with either HOXC13-AS siRNA or control siRNA for 24 hours (n=3 per group) and transcriptomic profiling was performed using human Clariom™ S assays (ThermoFisher Scientific) at the core facility for Bioinformatics and Expression Analysis (BEA ...
-
bioRxiv - Bioengineering 2023Quote: Human prostate adenocarcinoma cell line PC-3 was maintained in DMEM (HyClone, Cytiva) plus 10% fetal bovine serum (GIBCO, Thermo Fisher Scientific), and 100 Units/ml Pen-Strep (GIBCO ...
-
bioRxiv - Bioengineering 2023Quote: Human prostate adenocarcinoma cell line PC-3 was maintained in DMEM (HyClone, Cytiva) plus 10% fetal bovine serum (GIBCO, Thermo Fisher Scientific), and 100 Units/ml Pen-Strep (GIBCO ...
-
bioRxiv - Developmental Biology 2021Quote: ... recombinant murine EGF (50 ng/ml; Thermo Fisher Scientific), recombinant murine Noggin (100 ng/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... including 1.25 U Taq recombinant DNA polymerase (Invitrogen, USA), 1x PCR Buffer (-Mg) ...
-
bioRxiv - Molecular Biology 2021Quote: ... recombinant murine EGF (50 ng/mL; Thermo Fisher Scientific), recombinant murine Noggin (50 ng/mL ...
-
bioRxiv - Genomics 2020Quote: ... treated with RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific). Library concentrations were determined using Qubit Fluorometer (v.4.0 ...
-
bioRxiv - Genomics 2020Quote: ... treated with RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific). Library concentration was determined using Qubit Fluorometer (v.4.0 ...
-
bioRxiv - Neuroscience 2019Quote: ... Briefly recombinant Protein G Agarose beads (ThermoFisher cat# 15920010) were washed three times with PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific # 10777019) according to manufactures instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Indicated amounts of recombinant GFP-His (Thermo Fisher # A42613) or SARS-CoV-2 N-His (Sino Biological # 40588-V08B ...
-
bioRxiv - Immunology 2021Quote: ... goat anti-mouse IgG Fab recombinant secondary antibody (Invitrogen), anti-NKp46 (9E2 ...
-
bioRxiv - Genetics 2021Quote: ... Extracted RNA was treated with Recombinant DNaseI (Thermo Scientific) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 25 µL packed Recombinant Protein A-Sepharose 4B (Invitrogen) was used to capture the immune complexes for 1 hour at RT ...
-
bioRxiv - Genetics 2022Quote: ... and 200 μg/mL recombinant proteinase K (Thermo Scientific). The mixture was incubated at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 40U RNaseOUT Recombinant Ribonuclease Inhibitor (Invitrogen, Antisel SA, Hellas) and 4 μM random hexamer primers (Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 units/mL RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermofisher); 0.5 mM Spermidine (#S2626 ...
-
bioRxiv - Neuroscience 2022Quote: The following recombinant proteins were used: CaMKIIα (#PR4586C, Invitrogen), GST-CaMKIIβ (#02-110 ...
-
bioRxiv - Molecular Biology 2020Quote: ... recombinant murine EGF (50 ng/mL; Thermo Fisher Scientific), recombinant murine Noggin (100 ng/mL ...
-
bioRxiv - Genetics 2021Quote: ... and RNaseOUT recombinant ribonuclease inhibitor (#10777019, Thermo Fisher Scientific). All RNA samples were reverse transcribed using the LunaScript™ RT supermix kit (#E3010L ...
-
bioRxiv - Microbiology 2020Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) as described above ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 unit/μl RNaseOUT ™ Recombinant Ribonuclease Inhibitor (Invitrogen), and 20mM Tris-HCl/10% glycerol for 25 minutes in ice ...
-
bioRxiv - Genetics 2019Quote: ... and 200 µg/mL recombinant proteinase K (Thermo Scientific). The mixture was incubated at 37°C for 30 min and then 95°C for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... followed by incubation with recombinant Protein G agarose (Invitrogen) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... ISG15 recombinant rabbit monoclonal antibody (1□00) (Invitrogen, 703132), and collagen I (1□100 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 50 ng/ml recombinant mouse EGF (Thermo Fisher Scientific), 100 ng/ml recombinant human IGF-1 (BioLegend) ...
-
bioRxiv - Biophysics 2020Quote: Production of recombinant baculovirus followed the manufacturer’s protocol (Invitrogen). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Recombinant protein expression and purification FreeStyle 293F (ThermoFisher Scientific) cells were grown to a density of 1×106 cells/mL at 37°C with 8% CO2 with regular 135 rpm agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% (v/v) RNaseOUT recombinant ribonuclease inhibitor (Invitrogen). The lysates were cleared by centrifugation at 200,000 ×g for 10 min at 4°C 3 times to remove the contamination of the lipid ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% (v/v) RNaseOUT recombinant ribonuclease inhibitor (Invitrogen). 10% of the precipitates were analyzed by western blotting to check the protein immunoprecipitation efficiency ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Recombinant proteins were produced in Expi293F cells (Gibco, #A14527) following the manufacturer’s directions ...
-
bioRxiv - Genomics 2022Quote: ... 0.5 μL RNaseOUT™ Recombinant Ribonuclease Inhibitor (Invitrogen, 10777019) was then added to each well ...
-
bioRxiv - Biophysics 2022Quote: ... Recombinant EcoSSB and Sequenase© were purchased from Thermofisher. T7DNAp was purchased from NEB ...
-
bioRxiv - Microbiology 2023Quote: ... recombinant proteins were purified using Ni-NTA agarose (ThermoFisher), and then buffer exchanged into PBS and concentrated using Amicon Ultracel centrifugal filters (EMD Millipore).
-
bioRxiv - Microbiology 2023Quote: ... Recombinant protein A/G conjugated to HRP (Thermo Fisher) diluted 1:500 in TBST was added each well and the plates were incubated for 1 hour at 37°C then washed four times with TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... 60 units of RNaseOUT Recombinant RNase Inhibitor (Invitrogen, 10777019) was added to each sample and vortexed for 5 seconds ...
-
bioRxiv - Microbiology 2023Quote: ... Indicated amounts of recombinant GFP-His (Thermo Fisher # A42613) or HCoV-OC43 N-His (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2023Quote: ... recombinant SARS-CoV-2 S protein (RP-87680, Invitrogen) or recombinant SARS-CoV-2 spike RBD protein (40592-V08H ...