Labshake search
Citations for Thermo Fisher :
851 - 900 of 10000+ citations for Recombinant Human CER1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: All PCRs were performed by using Recombinant Taq polymerase (Thermo Scientific). 100 ng of the synthesized DNA was mixed with 1X PCR buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... or 20mg/mL proteinase K (recombinant PCR grade, ThermoFisher Cat# EO0492) for 10 ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant rabbit monoclonal anti-LUM (Lumican, Invitrogen Cat#MA5-29402). The samples were subsequently digitized using a NanoZoomer Hamamatsu S60 digital slide scanner.
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Cancer Biology 2024Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing colon organoids ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human transferrin-568 (ThermoFisher) was added at 10μg mL−1 concentration in serum free media and incubated at 37°C to allow for internalization ...
-
bioRxiv - Immunology 2021Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: Probes Hs00171064_m1 (human, ThermoFisher), Mm00440280_g1 (mouse ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary human hepatocytes (Gibco) were seeded in the top channel at a density of 3.5 x 106 cells/mL using complete hepatocyte seeding media ...
-
bioRxiv - Immunology 2020Quote: ... or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... or human IgG (Invitrogen) as control ...
-
bioRxiv - Bioengineering 2022Quote: ... and human fibronectin (Gibco) at 50 μg/mL in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... human (ThermoFisher Scientific, 902927). Analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% human IgG (Invitrogen) in PBS] followed by incubation with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (ThermoFisher, #33016015); Laminin 111 ...
-
bioRxiv - Immunology 2023Quote: ... A Human ProcartaPlexTM (Invitrogen) immunoassay was additionally used to detect 45 human cytokines ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD36 (Human tissue Thermofisher: PA1-16813 1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were tested on preconfigured 96-well qPCR plates (Human glycosylation – 4413255, Human Inflammation - 4418851 or Human tumor metastasis – 4418743, Thermofisher Scientific), with 100 ng added to each well ...
-
bioRxiv - Molecular Biology 2021Quote: ... HeLa cells in 35-mm dishes were transfected with 100 pmol of each siRNA in the Stealth siRNA library targeting 154 human nuclear proteins (Invitrogen–Thermo Fisher Scientific) using Lipofectamine RNAiMax (Invitrogen–Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: Cell culture supernatants were analyzed for secreted proteins using Immune Monitoring 65-Plex Human ProcartaPlex™ Panel for MAGPIX (Thermofisher Scientific, Carlsbad, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Cell culture supernatants were analyzed for secreted proteins using Immune Monitoring 65-Plex Human ProcartaPlex™ Panel for MAGPIX (Thermofisher Scientific, Carlsbad, CA) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: Epidermal growth factor receptor (EGFR) protein expression levels on the surface of Gli36-derived EVs were quantified using an EGFR Human ELISA kit (ThermoFisher Scientific, Waltham, MA). EVs were spiked in healthy donor serum at different concentrations ranging from 0 to 1.0E11 particles/mL while maintaining the serum-derived EV concentration at 1.0E9 particles/mL ...
-
bioRxiv - Immunology 2023Quote: To assess thermodynamic stability of human and bat (M. myotis and M. capaccinii) purified IgG molecules we used Protein Thermal Shift Dye Kit (Applied Biosystems, Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... were determined by matching the UniProt human protein database (release 2023_01) with the acquired fragmentation pattern using Sequest (Thermo Fisher Scientific, Waltham, MA) (Eng et al. ...
-
bioRxiv - Microbiology 2020Quote: ... we used human monoclonal antibodies produced recombinantly in human Expi293F cells (Life Technologies) as described before (Fang et al ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-human IgG-Alexa647 and anti-human IgG-Alexa568 were obtained from Invitrogen, anti-acetylated tubulin (T7451 ...
-
bioRxiv - Cell Biology 2020Quote: ... and human GAPDH and human KIF18A Taqman probes and primers (Thermo Fisher Scientific) were used for reverse transcription and qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and subjected to human total tau ELISA (human tau: # KHB0042, Thermo Fisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen), which was detected using an ECL Advance Western Blotting Detection Kit (Amersham ...
-
bioRxiv - Molecular Biology 2020Quote: Recombinant 6x-His tagged PTB was purified using Ni-NTA agarose (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Recombinant BUD13 purification was confirmed by SimplyBue SafeStain (Thermo Fisher Scientific, LC6060) and western blot using BUD13 antibody (Bethyl Laboratories ...
-
bioRxiv - Immunology 2019Quote: ... slices were overlaid with 50ng recombinant IL-15/IL-15Rαcomplex (Thermo Fisher) in 10□1 of cRPMI following peptide treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant virus was made by co-transfection into SF9 insect cells (Invitrogen) of the plasmid and BacVector3000 baculovirus DNA (Novagen ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2) 1 U/μL RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific). Hydra polyps in MCB buffer were homogenized on ice using a Dounce homogenizer ...
-
bioRxiv - Immunology 2019Quote: ... recombinant macrophage colony-stimulating factor (100 U/ml; ebioscience, Thermo Fisher Scientific) and Pen Strep (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 ng/ml recombinant mouse macrophage colony-stimulating factor (Gibco, Burlington, ON), and penicillin/streptomycin antibiotics ...