Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for Recombinant Mouse Ifnl3 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... on plates coated with recombinant human collagen I (Coating Matrix kit, Gibco) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA) at 37 °C and 5 % carbon dioxide ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human recombinant plasminogen activator inhibitor 1 (PAI-1) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA). The incubator condition was set at 37 °C with 5 % carbon dioxide environment ...
-
bioRxiv - Cell Biology 2023Quote: ... human recombinant fibroblast growth factor 2 (FGF2, 20 ng/mL, Life Technologies), and beta-mercaptoethanol (0.1% ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant human IFN-β (1000 U/ml to 1 U/ml, ThermoFisher) was used as positive controls for IRF activation ...
-
bioRxiv - Cancer Biology 2023Quote: ... human recombinant EGF (10 ng/ml) (Thermo Fisher Scientific, Waltham, MA, USA), D-glucose (5.5 mM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... bovine pituitary extract and human recombinant epidermal growth factor (Gibco, 37000-015)) and primary gingival keratinocyte (Dermal cell basal medium (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: ... hiPSCs were cultured on human recombinant vitronectin in StemFlexTM media (Life Technologies) and differentiation was initiated by plating singularised hiPSCs on human embryonic stem cells (hESC)-qualified Matrigel (Corning ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... mouse anti-mouse PCSK9 (Invitrogen), mouse anti-mouse vinculin (Santa Cruz) ...
-
bioRxiv - Microbiology 2020Quote: ... the sections were sequentially incubated with mouse polyclonal antibody to SARS-CoV-2 N protein (1:500 dilution) and HRP-conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen). The sections were observed under microscope (Olympus ...
-
bioRxiv - Neuroscience 2021Quote: ... Chromatin antibody complexes were isolated using protein A-beads for rabbit primary antibodies or G-beads for mouse primary antibodies (Dynabeads, Invitrogen). The PCRs with 1:20 dilutions of genomic DNA (input ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-TRF1 antibody (Goat Pab sc-1977, SantaCruz), or anti-PAR (Mouse Mab 10H ALX-804220, Alexis) recovered with Protein-G dynabeads (Invitrogen), run on PAGE together with input sample (1:20 of amount of immunoprecipitated proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... MS/MS database search was performed against in silico tryptic digest of mouse proteins UniProt FASTA database using SEQUEST HT within Proteome Discoverer 2.2 (PD 2.2, Thermo Fisher Scientific) with precursor mass tolerance of 10 ppm and fragment mass tolerance of 0.02 Da ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse IP6K1 was sub-cloned into SFB (S-protein/FLAG/SBP) - tagged destination vector using the Gateway cloning strategy (Invitrogen). Catalytically inactive IP6K1 (K226A ...
-
bioRxiv - Genomics 2020Quote: ... We also validated protein expression and inducibility of the KRABINER rescue transgenes via western blot (mouse anti-myc antibody ThermoFisher #MA1-21316 ...
-
bioRxiv - Microbiology 2021Quote: ... the sections were incubated with house-made mouse anti-SARS-CoV-2 nucleocapsid protein serum (1:5000) and HRP465 conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen). The lung sections from the vector-transduced mouse were used as negative control ...
-
bioRxiv - Bioengineering 2021Quote: ... Immunostaining of BBB constructs for tight junction protein ZO-1 was conducted using ZO-1 mouse monoclonal antibody conjugated with Alexa 488 (ThermoFisher). Hydrogels were removed from the transwell insert using a biopsy punch ...
-
bioRxiv - Neuroscience 2021Quote: ... The tandem mass spectra were searched using SEQUEST 80 search algorithms against a Uniprot database (human 2019_07 release for 293T CoIP and mouse 2019_08 release supplemented with human TDP-43 protein sequence for mouse CoIP) through the Proteome Discoverer platform (version 2.5, Thermo Scientific). The search parameters included a maximum of two missed cleavages ...
-
bioRxiv - Cell Biology 2021Quote: ... Each protein of interest was then detected with HRP-conjugated goat anti-rabbit or anti-mouse IgG antibody (1:2000; Invitrogen), and visualized using SuperSignal West Pico PLUS Chemiluminescent Substrate or SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2020Quote: ... Secondary detection of bait proteins was performed in 2.5% bovine serum albumin (BSA) in PBS using goat anti-mouse Alexa FluorTM 488 (Molecular Probes, ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Mex67-3Flag tagged protein was isolated using 200 µL of pre-washed magnetic Pan Mouse Dynabeads (Thermo Fisher Scientific) coupled to 34 µg of anti-Flag M2 mouse monoclonal antibody (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... The autophosphorylation of hIRE1 KR was confirmed by western blot using a pSer/24 phospho-specific antibody (Genentech) and phosphorylated Pumilio proteins were detected using anti-mouse-V5 antibody (Invitrogen). In the case of kinase radioactive assays ...
-
bioRxiv - Molecular Biology 2022Quote: ... The combined data set of 9 injections were mapped against the mouse protein database using Proteome Discoverer v2.4 and the Sequest HT search algorithm (Thermo Scientific) with label-free quantitation (LFQ ...
-
bioRxiv - Neuroscience 2021Quote: NAc samples were pooled from four D1-Cre-RT or D2-Cre-RT male and female mice and RNA isolation from immunoprecipitated polyribosomes using primary mouse anti-HA antibody (Covance Research Products, Cat#MMS101R) and secondary antibody coated magnetic Dynabeads (Dynabeads protein G, Invitrogen) to pulldown the MSN specific RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... TAP purification was carried out as previously described 48 with 2 mg of protein extract and 50 μl of Dynabeads Pan Mouse IgG (Invitrogen) per sample ...
-
bioRxiv - Microbiology 2020Quote: ... Cleavage of junctional proteins was detected by Western blot analysis using specific antibodies against E-cadherin (Mouse, mAb, Thermo Scientific), p120-catenin (Rabbit ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The presence of AhR and ARNT proteins was verified by Western blot using anti-His-tag (mouse monoclonal, MA1-21315, dilution 1:1000, Invitrogen) anti-FLAG-tag (rabbit monoclonal ...
-
bioRxiv - Immunology 2020Quote: ... slides were stained with the following secondary antibodies: polyclonal goat anti-Mouse Alexa Fluor488 to detect CD68 protein (Green color) (A-11029, Invitrogen) or polyclonal goat anti-Rabbit Alexa Fluor546 to detect SP140 protein (Orange color ...
-
bioRxiv - Neuroscience 2022Quote: ... 50 and 35µg of proteins (for cell lysates, mouse brains and human cortices, respectively) were added with 1x Sample buffer (Thermo Fisher) and 1x Sample Reducing Agent (Thermo Fisher) ...
-
bioRxiv - Evolutionary Biology 2022Quote: We synthesized the Bowhead whale CDKN2CRTG protein with mouse codon usage (GeneScript) and directly cloned the synthesized gene into the pcDNA3.1-C-eGFP vector (Life Technologies), which added a C-terminal eGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... The horseradish peroxidase (HRP)-conjugated Protein A or HRP-conjugated rabbit anti-mouse secondary antibody for immunoblotting were from Invitrogen. The alpha smooth muscle actin (# ab7817) ...
-
bioRxiv - Molecular Biology 2023Quote: The raw data files acquired from each sample were searched against mouse protein sequences database using the Proteome Discoverer 1.4 software (Thermo Scientific) based on the SEQUEST algorithm ...
-
bioRxiv - Cancer Biology 2023Quote: 20 μg protein per sample was used for the IFN-gamma mouse ProcartaplexTM Simplex High Sensitivity kit (Thermo Fisher Scientific) and the protocol was followed as per the product manual ...
-
bioRxiv - Genetics 2022Quote: ... About 50ug total protein from cell extracts were blotted and hybridised with the primary antibody of Mouse anti-V5 (Invitrogen) for CLK and BMAL1 expression then the secondary antibody of horseradish peroxidase-conjugated either anti-mouse or anti-rabbit IgG antibody (Sigma) ...