Labshake search
Citations for Thermo Fisher :
801 - 850 of 6380 citations for Recombinant Human EPHB4 None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Immunology 2024Quote: ... used for recombinant protein production were maintained in FreeStyle (ThermoFisher, #12338026) or Expi293 media (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing colon organoids ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant proteins were diluted in DPBS (Life technologies cat. # 14040-182) (tetNA was diluted to 0.5 µg/ml) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human transferrin-568 (ThermoFisher) was added at 10μg mL−1 concentration in serum free media and incubated at 37°C to allow for internalization ...
-
bioRxiv - Immunology 2021Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: Probes Hs00171064_m1 (human, ThermoFisher), Mm00440280_g1 (mouse ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary human hepatocytes (Gibco) were seeded in the top channel at a density of 3.5 x 106 cells/mL using complete hepatocyte seeding media ...
-
bioRxiv - Immunology 2020Quote: ... or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... or human IgG (Invitrogen) as control ...
-
bioRxiv - Bioengineering 2022Quote: ... and human fibronectin (Gibco) at 50 μg/mL in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... human (ThermoFisher Scientific, 902927). Analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% human IgG (Invitrogen) in PBS] followed by incubation with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (ThermoFisher, #33016015); Laminin 111 ...
-
bioRxiv - Immunology 2023Quote: ... A Human ProcartaPlexTM (Invitrogen) immunoassay was additionally used to detect 45 human cytokines ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD36 (Human tissue Thermofisher: PA1-16813 1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were tested on preconfigured 96-well qPCR plates (Human glycosylation – 4413255, Human Inflammation - 4418851 or Human tumor metastasis – 4418743, Thermofisher Scientific), with 100 ng added to each well ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Sybr Safe DNA gel stain and BenchMark™ His-tagged Protein Standard were purchased from Invitrogen. HRP-conjugated 6*His His-Tag Mouse McAB was obtained from Proteintech ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... His-tagged proteins were eluted from the beads in a disposable polypropylene column (29924, ThermoFisher Scientific) using elution buffer (4 ml wash buffer containing 400 mM imidazole ...
-
bioRxiv - Genetics 2021Quote: ... Epitope-tagged bait proteins were detected with mouse anti-c-myc monoclonal antibody (Invitrogen, MA1-980) and IR-680 conjugated donkey anti-mouse secondary antibody (LI-COR ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... T0M20 antibodies (polyclonal, cat number PA5-52843) and Alexa 568-tagged secondary antibodies were from ThermoFisher. The imaging was performed using Nikon SP-1 microscope and analyzed using FIJI (Schindelin et al. ...
-
bioRxiv - Cell Biology 2019Quote: Creation of the 3xmEGFP tagged RabE12 construct occurred by a two-element LR Gateway reaction (ThermoFisher) of entry clones pENT-L1-3xmEGFP-L5r and pENT-L5-RabE12-L2 ...
-
bioRxiv - Neuroscience 2020Quote: ... N-terminally HA-tagged AMPAR constructs were expressed from the doxycycline inducible pcDNA4/TO vector (Invitrogen Cat ...
-
bioRxiv - Biochemistry 2021Quote: Immunoprecipitation of HA tagged GAPDH (TDH3-HA) was performed using Pierce anti-HA beads (Thermo Fisher). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... 200 μl and the tagged Aβ(1-40) is incubated with Ulp1 SUMO-protease (either Invitrogen or produced recombinantly (Malakhov ...
-
bioRxiv - Neuroscience 2020Quote: ... media was collected and His tagged proteins were bound using HisPur Ni-NTA Resin (ThermoFisher; 88221) in the presence of Calbiochem’s EDTA-free protease inhibitor cocktail 1:1000 (MilliporeSigma ...
-
bioRxiv - Biophysics 2021Quote: ... they were transfected with EGFP tagged wt LA/A350P DNA along with Lipofectamine 2000 (Invitrogen, USA) in a ratio 1:1.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... His-tagged ChElp2 was pulled-down with Dynabeads™ His-Tag (Thermo Fisher Scientific, Massachusetts, USA) and the subsequent western blot analyses were performed with anti-His (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: MCF-7 Cells were fluorescently tagged with CellTracker™ Green CMTPX dye (Invitrogen™, Waltham, MA). A stock solution of 10 mM was prepared according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... In some cases 200-400 nl of fluorescent-tagged material (20% solution of FluoroEmerald Molecular Probes, Eugene ...
-
bioRxiv - Microbiology 2020Quote: The Avi-tagged BG505 gp140.664.R1 trimer probe was transiently expressed in HEK293F cells (Thermo Fisher) (67) ...
-
bioRxiv - Biochemistry 2021Quote: 1-2 μg His-tagged calcineurin was first bound to magnetic Dynabeads (Thermo Fisher Sci. USA) in base buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein A-tagged proteins were detected with HRP-conjugated polyclonal anti-Protein A (Invitrogen, PA1-26853) at 1:5000.
-
bioRxiv - Immunology 2020Quote: ... The resultant FLAG-tagged STAT3 constructs were transfected into 293T using lipofectamine 3000 (Thermo Fisher Scientific). 48 hours after transfection cells were lysed (50mM Tris ...
-
bioRxiv - Genetics 2019Quote: ... Proteins tagged with the V5 epitope (Hxk2, Reg1) were detected with the Anti-V5 probe (Invitrogen) diluted 1:1,000 ...
-
bioRxiv - Plant Biology 2022Quote: ... GST and GST-tagged SAMS were incubated with 40 μl GST magnetic beads (Thermo Fisher Scientific) for 1 h at 4°C and then these beads were washed three times with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... we used PrepEase Histidine-tagged Protein Purification Midi Kit-High Yield (Affymetrix, Santa Clara, CA, USA) or Protino Ni-IDA 2000 packed columns (Macherey-Nagel ...