Labshake search
Citations for Thermo Fisher :
801 - 850 of 7935 citations for IL 12RB1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: HEK293 cells and A549 cells were cultured in DMEM media (Thermo Fisher #11965-092) containing 1% Pen/Strep and 10% FBS (VWR International ...
-
bioRxiv - Biochemistry 2023Quote: HEK293 and C6 glioblastoma cells were cultured in Dulbecco’s Modified Eagle’s medium (DMEM; Gibco) supplemented with 10% heat-inactivated fetal calf serum (HI-FCS ...
-
Analysis of RyR2 distribution in HEK293 cells and mouse cardiac myocytes using 3D MINFLUX microscopybioRxiv - Physiology 2023Quote: ... fixed HEK293 RyR2D4365-GFP cells were incubated with MA3-916 RyR2 monoclonal antibody (Invitrogen) diluted 1:100 at 4°C overnight in the same solution as above ...
-
bioRxiv - Cell Biology 2023Quote: ... and HEK293 (ATCC) and were all grown in 1x DMEM based media (ThermoFisher Scientific) with 1% Penicillin and Streptomycin (Pen/Strep ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Flp-In HEK293 cells were cultured in high glucose pyruvate medium (Gibco, #10569010), supplemented with 10% FBS (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... the transiently transfected HEK293 cells were harvested using dissociation buffer TrypLE (Thermo Fisher Scientific) and binding assay buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and HEK293 cells were cultivated in Dulbecco’s Modified Eagle Medium (DMEM; TM4, HeLa: Gibco™ #41966 – high glucose ...
-
bioRxiv - Bioengineering 2023Quote: The plasmid was transfected into HEK293 cells using Lipofectamine 3000 Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were cultured in DMEM/F-12 cell culture medium (Gibco, Carlsbad, CA) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... FreeStyle™ HEK293-F cells were cultured in Freestyle™ 293 expression medium (Gibco).
-
bioRxiv - Neuroscience 2023Quote: ... The Flp-In T-REx HEK293 cell line was used (Thermo Fisher Scientific, R78007). Stably expressing cells were isolated by treating with 200 µg/mL hygromycin B (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Reverse transfection was used to transiently transfect HEK293 cells using Lipofectamine 3000 (Thermo Fisher), using the method provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plasmids were transfected into HEK293-T or LNCaP cells using Lipofectamine 2000 (Invitrogen) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples generated from HEK293 cells were analyzed with an LTQ-Orbitrap Velos (Thermo Fisher) while samples from HeLa cells with a Q Exactive (Thermo Fisher) ...
-
bioRxiv - Biophysics 2024Quote: 5×105 HEK293 cells were plated on a 35 mm cell culture dish (Nunc) one day before transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cultured in RPMI with 5 % heat inactivated human serum (HS) and 2 ng/mL interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). In vitro experiments with KJON cells were performed with 2 % HS in RPMI and IL-6 (1 ng/mL) ...
-
bioRxiv - Microbiology 2024Quote: ... C-His-OipA protein was purified by using Dynabeads™ His-Tag Isolation and Pulldown magnetic bead system (Thermo Fisher Scientific, United States). His-tagged OipA protein isolation procedure was carried out according to kit instructions ...
-
bioRxiv - Microbiology 2022Quote: ... interleukin-10 (IL-10) and interleukin-4 (IL-4) levels by sandwich ELISA kits (ThermoFisher Scientific). The measurement from unstimulated splenocytes (incubated with medium only ...
-
bioRxiv - Immunology 2022Quote: ... either alone or with anti-IL-1β or anti-IL-6 neutralizing antibodies (Thermofisher, Waltham, MA), and ensuing protein lysates blotted for phosphorylated STAT-3 (pSTAT3) ...
-
bioRxiv - Immunology 2021Quote: ... UltraComp eBeads™ and mouse IL-5/IL-13 ELISA kits were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... Murine IL-2 ELISA’s were performed using the mouse IL-2 ELISA kit (Thermo Fisher Scientific).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Plasma IL-6 levels were measured by mouse IL-6 ELISA kit (ThermoFisher Scientific, Waltham, MA).
-
bioRxiv - Immunology 2020Quote: ... IL-2 was measured from culture supernatants using a mouse IL-2 ELISA kit (Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: ... and IL-12 levels were determined using the IL-12 p70 Mouse Uncoated ELISA Kit (Invitrogen). Isolated tumors were snap-frozen on dry ice ...
-
bioRxiv - Immunology 2022Quote: ... IL-6 measurement was performed using IL-6 Mouse Uncoated ELISA Kit (88-7064-22; Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... IFN-γ IL-4 and IL-6 were measured by Mouse Uncoated ELISA Kit (Invitrogen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), and forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2021Quote: ... anti-IL-23p19-AF488 (fc23cpg, Invitrogen); anti-IL-1β-APC (NJTEN3 ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-6 (20 ng/mL, ThermoFisher). To generate human induced pluripotent stem cells (iPSCs) ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-3 (20 ng/mL, ThermoFisher), IL-6 (20 ng/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... 100ng/ml IL-4 (Gibco, USA) for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-4 (Gibco), 10 ng/ml IL-10 (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... caveolin-2 (Thermo Fisher, Rockford, IL), and STIM1/CRACR2A (CRAC regulator 2A ...
-
bioRxiv - Microbiology 2021Quote: ... anti-mouse IL-1β (Invitrogen, # 701304); anti-mouse Cleaved IL-1β (Cell Signaling Technology ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylbenzidine (ThermoFisher Scientific, Rockford, IL, USA) and read at 450 nm according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2020Quote: ... IL-18 Mouse ELISA kit (ThermoFisher), and ELISA MAX Deluxe Set Mouse TNFα (Biolegend) ...
-
bioRxiv - Systems Biology 2022Quote: ... and IL-8 (Invitrogen, catalog # KHC0081) levels in the media samples were conducted according to the manufacturer’s protocol.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... in duplicate by ThermoFisher (Life Technologies Corporation, Chicago, IL 60693) using Z’Lyte (76) ...
-
bioRxiv - Cell Biology 2022Quote: ... IL-8 (ThermoFisher Scientific, catalog # PHC0884), and ChaCha (Anaspec ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-10 (ThermoFisher Scientific, Waltham, MA), and IL-1β (R&D Systems ...
-
bioRxiv - Immunology 2021Quote: ... IL-4 (Invitrogen, #12-7041-41) and Foxp3 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... and anti-IL-2 APC (Invitrogen) in permeabilization buffer for 30 min ...
-
bioRxiv - Physiology 2021Quote: ... TRIzol reagent (Thermo Scientific, Rockford, IL) was used to extract the total RNA from pepper and N ...
-
bioRxiv - Immunology 2020Quote: ... anti-mouse IL-6 (ThermoFisher, USA), Alexa Fluor® 594 conjugate secondary antibody (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... anti-mouse IL-2 (ThermoFisher, USA), Alexa Fluor® 594 conjugate secondary antibody (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-IL-1β antibody (Invitrogen), mouse anti-MCP-1 antibody (Abcam) ...
-
bioRxiv - Immunology 2022Quote: ... IL-6 (100 ng/ml, Invitrogen), TNF-α (10 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... IL-17A (Invitrogen, #88-7371-88), or IL-5 (BD Biosciences ...