Labshake search
Citations for Thermo Fisher :
801 - 850 of 6145 citations for GDF 11 BMP 11 Human HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: HEK293 cells were transfected with the NeonTM transfection kit (Invitrogen) according to the manufacturer’s description ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293 Flp-In T-REx cells (Thermo Fisher Scientific, R78007) with SBP-tagged eIF4A1 integrant 15 were seeded in a 10-cm dish and cultured for 3 d in the presence of 1 μg/ml tetracycline ...
-
bioRxiv - Systems Biology 2023Quote: ... HEK293 cell lines were lifted using TrypLE Express (Thermo Fisher) and resuspended in media supplemented with the appropriate volume of cADDis BacMam ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293 in Dulbecco’s modified Eagle Medium (DMEM, Life Technologies #11965118); T-47D in Roswell Park Memorial Institute (RPMI ...
-
bioRxiv - Cell Biology 2023Quote: Flp-In™ T-REx™ HEK293 cells (Invitrogen, R78007) containing a single genomic FRT site and stably expressing the Tet repressor were cultured in DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Developmental Biology 2024Quote: HEK293 cells were transfected using Lipofectamine 3000 (Invitrogen, Cat# L3000008) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Flp-In T-Rex HEK293 cell lines (Thermo Fisher Scientific) expressing mitochondrial-relocated golgin-BirA* fusions (from John Shin ...
-
bioRxiv - Biochemistry 2024Quote: ... GKO HEK293 cells were maintained in DMEM (Gibco Cat# 11995065) containing 10 % FBS (Gibco Cat# 16000044) ...
-
bioRxiv - Cell Biology 2024Quote: FlpIn CHO and HEK293 cell lines were purchased from Invitrogen and maintained in Dulbecco’s Modified Eagle’s Medium supplemented with 5% Foetal Bovine Serum (ThermoFisher Scientific (Gibco) ...
-
bioRxiv - Cell Biology 2024Quote: Flp-In T-Rex HEK293 cells (Invitrogen, Thermo Fisher Scientific) were co-transfected with plasmids pOG44 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: Flp-In T-Rex HEK293 cells (Invitrogen, Thermo Fisher Scientific) were co-transfected with plasmids pOG44 (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293 GnTI- cells were cultured in Freestyle 293 medium (Invitrogen) supplemented with 2% FBS on a shaker at 37 °C in the presence of 8% CO2 to a density of 3 × 106 cells per ml ...
-
bioRxiv - Neuroscience 2023Quote: ... Stable HEK293 lines were generated by lipofection (Lipofectamine 2000, ThermoFisher) of ∼80% confluent cells with 2 µg of linearized expression plasmid overnight according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... double-stranded oligonucleotides containing eight BMP-responsive elements in tandem (8×BRE; AGATCCTCTGGTCACAGGATAATAATCCTGACGCCAGAAAGTCTGGAGGTC) were synthesized (GeneArt, Invitrogen) and introduced into the pNL3.2[Nluc_minP] vector (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... to form embryoid bodies (EBS) in mTeSR1 supplemented with 50 ng ml−1 BMP-4 (Life Technologies, PHC9531), 50 ng ml−1 VEGF (Thermofisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK293 cells were then stimulated with 25 ng/ml EGF (Gibco) for 5 min (other cell lines were not stimulated) ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) supplemented with 10% (v/v ...
-
A nepenthesin insert allosterically controls catalysis in the malaria parasite protease plasmepsin VbioRxiv - Microbiology 2022Quote: ... HEK293-F cells were cultured in FreeStyle 293 Expression Medium (ThermoFisher). A days before transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfection of HEK293 cells was carried out using Lipofectamine2000 (ThermoFisher) after cells reach a confluency of 70%.
-
bioRxiv - Neuroscience 2020Quote: ... HEK293 cells were cultured with Dulbecco’s Modified Eagles Media (DMEM) (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: HEK293 and COS-7 cells were transfected with Lipofectamine 2000 (Invitrogen) according to manufacturer’s specifications ...
-
bioRxiv - Biochemistry 2020Quote: HEK293T (ATCC) and HEK293 (ATCC) cells were cultured in DMEM (Invitrogen) plus 10% FBS (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... Transfections of HEK293 were performed with 4 μL Lipofectamine 2000 (Invitrogen) and 1-2.5 μg plasmid DNA per 35 mm2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293 cells were maintained in Eagle’s Minimum Essential Medium (EMEM; Gibco) and SH-SY5Y cells in Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 (DMEM/F12 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293-hCD4 were detached using enzyme-free cell dissociation buffer (Gibco) and resuspended in FACS buffer (PBS containing 5% FBS) ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 (HEK) cells were grown in DMEM Media (Thermo Fisher Scientific) supplemented with 1mM Glutamax (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293-T cells (AccessionID: CRL_3216) were cultured DMEM without phenol (Gibco) with the same conditions for aforementioned supplements ...
-
bioRxiv - Molecular Biology 2020Quote: Flp-In T-REx HEK293 (Thermo Fisher Scientific Catalog Number: R78007) cells were kept according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: Cells employed in this study are HEK293 (Gibco 293-H cells), N2a.dd-EGFP (a neuro-2a mouse neuroblastoma cell line developed by us containing a single integrated copy of an EGFP-DHFR[DD] [EGFP-folA dihydrofolate reductase destabilization domain] fusion protein coding cassette originating from a donor plasmid with 1,000 bp long homology arms to the Prnp gene driven by the Prnp promoter (Prnp ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293 cells were transfected with Cxcl8-mCherry using Lipofectamine-2000 (Invitrogen) (construct described in (Sarris et al. ...
-
bioRxiv - Biochemistry 2019Quote: HEK293 cells were cultured in Dulbecco’s modified Eagle medium (Glutamax, Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293-Flp-In T-Rex wild type (WT) (Thermo Fisher Scientific) and Gtpbp6−/− cell lines were grown under standard cultivation conditions 12 ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were cultured in DMEM + GlutaMAX-I (Thermo Fisher Scientific) with 10% FBS at 5% CO2 at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... mBTLA and mLIGHT constructs were transfected into HEK293 FreeStyle (Life technologies) cells using PEI (Linear Polyethylenimine with molecular weight of 25000 ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 and 3T3 cells were maintained in DMEM (Thermo Fisher Scientific) supplemented with 10% Cosmic Calf Serum (Thomas Scientific ...
-
bioRxiv - Genomics 2020Quote: ... were transfected into 60% confluent HEK293 cells using Lipofectamine LTX (Gibco) at the following ratio ...
-
bioRxiv - Neuroscience 2020Quote: HEK293 cells were grown in DMEM-glutamax medium (Gibco, Thermofisher Scientific) supplemented with 10% fetal calf serum (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: HEK293 cells were grown in DMEM-glutamax medium (Gibco, Thermofisher Scientific) supplemented with 10% fetal calf serum (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: HEK293 (ATCC CRL-3216) were cultured in DMEM (Gibco cat. # 11965092) supplemented with 10% fetal bovine serum (Gibco cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... 400000 Flp-In T-REx HEK293 cells (Thermo Fisher Scientific, R78007) were transiently transfected with precomplexed ribonuclear proteins (RNPs ...
-
bioRxiv - Cell Biology 2020Quote: Lentivirus was produced by transfecting HEK293-FT cells (Thermo Fisher Scientific) with the third-generation lentiviral vector system using lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: HEK293 cells were transfected using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher). Cells were harvested at 48 h post transfection ...
-
bioRxiv - Cell Biology 2021Quote: HEK293 cells were grown and maintained in DMEM/F12 medium (Gibco/Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: HEK293 cells were cultured in DMEM (GIBCO; Cat. No. 10313-039) supplemented with 10% FBS and 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were maintained in Dulbecco’s Modified Eagle’s medium (DMEM) (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... HEK293-F cells were grown in suspension using FreeStyle medium (Invitrogen). All cell lines were tested and confirmed mycoplasma-free using the protocol for Myco-Alert- Mycoplasma Detection Kit (LT07-218 ...
-
bioRxiv - Cell Biology 2022Quote: ... and FLP-In-293 (HEK293-FLP) cells purchased from Thermo Fisher Scientific (Cat # R75007) ...
-
bioRxiv - Molecular Biology 2022Quote: Cells employed in the studies are HEK293 (Gibco 293-H cells), GM08207 (Coriell Cell Repositories ...
-
bioRxiv - Biochemistry 2023Quote: Expi293F is a derivative of the HEK293 cell line (Thermo Fisher). Expi293F cells were grown in Expi293 Expression Medium (Thermo Fisher) ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293S GnTI-cells (ATCC) were cultured in Freestyle 293 medium (GIBCO) supplemented with 2% (v/v ...