Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for Ethyl 5 2 3 difluorophenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... on QuantStudio 5 (ThermoFisher) with primers specific to hamster genes encoding CCL2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Claudin 5 (CLDN5) (Thermofisher, Cat No ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithioerythritol (Invitrogen), 2.50 U/μL reverse transcriptase (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% Horse Serum (Gibco), and 1x Antibiotic/antimitotic (Corning).
-
bioRxiv - Cancer Biology 2024Quote: ... 5 uM dihydroethidium (Thermofisher), 20 uM 2’7’-dichlorofluorescin diacetate (DCFDA ...
-
bioRxiv - Immunology 2024Quote: ... – 5% DMSO (Fisher Scientific). Protocol for thymic pDCs isolation was based on Stoeckle et al ...
-
bioRxiv - Biophysics 2024Quote: ... 5% horse serum (Gibco), 2% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 0.5 mM of each dNTP (Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 0.5 mM of each dNTP (Fisher Scientific) ...
-
bioRxiv - Systems Biology 2023Quote: ... 5%FBS (Gibco, #10500064), and 0.1% Triton-X100 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... 5-flucytosine (Thermo Scientific), fosmanogepix (MedChem Express) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% NCTC-109 (Gibco), 60 μM β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% sodium pyruvate (GIBCO) and 5% penicillin and streptomycin (GIBCO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% horse serum (Invitrogen) and 10% FBS (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 5% FBS (Invitrogen), 5% horse serum (HS ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% FBS (Gibco, #A3160802) and 1% penicillin/ streptomycin (pen/ strep ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% horse serum (Invitrogen), 20 ng/ml EGF (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 (ThermoFisher), 20mM Tris-HCl pH 7.8 (ThermoFisher) ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... 5% Penicillin/Streptomycin (Gibco) and 2.5 mM L-Glutamine at 37°C in a humidified atmosphere with 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% EDTA (Invitrogen) route in accordance with IACUC guidance ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Genomics 2023Quote: ... 5% FBS (Life Technologies), 0.4 ug/mL Hydrocortisone (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... 5-FU (Fisher Scientific), cytosine (Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... 5% FBS (Life Technologies), 10 ng/mL human recombinant EGF (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cytokeratin 5 (AB_2538529, Thermofisher), Cytokeratin 8 (ab53280 ...
-
bioRxiv - Biochemistry 2023Quote: ... + 5 % FBS (Gibco #10500064) under antibiotic pressure using 5 μg/ml blasticidin (Gibco #A1113903 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% horse serum (Invitrogen) and 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM DTT (Invitrogen), 1 M betaine (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... DTT (5 mM, Invitrogen), RNaseOUT (40 U ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithiothreitol (Invitrogen), 500 nM FSE primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The RT-PCR reactions were performed by ABI QuantStudio 5 (Applied Biosystems) using 5 µL of PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM EDTA (ThermoFisher), 1% nonidet P-40 (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% B27 supplement (Gibco) and 5% Fetal Bovine Serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). Lysis of the cells was performed using RLT lysis buffer (Qiagen ...
-
bioRxiv - Immunology 2024Quote: ... with 5% FBS (Gibco). After 72h stimulation ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5% goat serum (Gibco), and 0.5% Triton X-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% FBS (Gibco) and 1% glutamine ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% mouse serum (Invitrogen) and 5% rat serum (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by sonication three times for 5 seconds with 5 seconds intervals at #5 (on dial) (Fisher Scientific 60 Sonic Dismembrator) on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were cultured at 37 °C in a humidified incubator at 21% oxygen/5% CO2 or 5% O2/5% CO2 (HeraCell Tri-Gas, ThermoFisher Inc).
-
bioRxiv - Cell Biology 2020Quote: The 5’ and 3’ ends of lncRAP2 was determined using the FirstChoice RLM-Race Kit from Ambion following the manufacturers instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... HCT116 cells complemented with chromosomes 3 and 5 were cultured with 400 μg/mL geneticin (G418, Gibco) and 6 ug/mL blasticidine (Invivogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Staining of cells was performed using 5 μl of DiBAC4(3) (Invitrogen, 0.025 mg/ml in DMSO) followed by incubation for 15 minutes at room temperature in dark ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-CAGGAAACAGCTATGAC-3’) and was subsequently recombined with the destination vector using LR Clonase (Thermo Fisher Scientific). The plasmids were then transformed in Agrobacterium tumfaciens strain GV3101.
-
bioRxiv - Cell Biology 2021Quote: ... Sections were washed 3-5 times with TBSTX buffer and then mounted on Superfrost slides (Fisher Scientific) with Slow fade Diamond mounting solution (Invitrogen ...