Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 8 mg/mL Yeast tRNA (Thermo Fisher Scientific, 15401011) and 100 µL DIG Easy Hyb (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Alexa 488 conjugated Claudin-5 (1:500; Invitrogen, 35-358-8), rabbit anti-CCL2 (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 μl 5-10 nM (TMR)-phalloidin (Invitrogen)-labeled bovine actin and incubated for 3 min ...
-
bioRxiv - Microbiology 2021Quote: ... covered by 2 x 9 cm2 pieces of parafilm stretched to fit (ThermoFisher Scientific Ltd.). The collection vessel was secured to a bench during collection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Time lapse imaging (15 minute intervals over 6h) of mCherry or CellTracker Deep Red (Thermo Fisher #C34565) signal was performed utilizing the Thermo Fisher ArrayScan VTI HCS platform ...
-
bioRxiv - Microbiology 2020Quote: ... RBD-6H (340-538; NITN.GPKK) was chemically biotinylated using EZ-link Sulfo-NHS-Biotin (A39256; Life Technologies). Serial half-log dilutions (starting at 1 μM ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Plant Biology 2020Quote: General ROS were detected using 2’-7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Invitrogen). CM-H2DCFDA was dissolved in DMSO to give a concentration of 1 mM and further diluted to a final concentration of 50 μM in water ...
-
bioRxiv - Cell Biology 2022Quote: The cell-permeant reagent H2DCFDA (2’, 7’-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific) was employed to represent the ROS levels in HeLa cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 7 minutes at 20 V using iBlot 2 (Thermo Fisher Scientific). Blots were blocked in 5% dried milk (AppliChem ...
-
bioRxiv - Cell Biology 2022Quote: ... + 1.6 mM Tris pH 7) and mounted in 1.2-2% agarose (Invitrogen) in 35mm #1.5 glass-bottom dishes (CellVis D35-20-1.5N and D35C4-20-1.5N) ...
-
bioRxiv - Cell Biology 2022Quote: ... + 1.6 mM Tris pH 7) and mounted in 1.2-2% agarose (Invitrogen) in 35mm #1.5 glass-bottom dishes (CellVis D35-20-1.5N) ...
-
bioRxiv - Molecular Biology 2023Quote: ... by the iBlot 2 transfer system (Invitrogen, 20 V for 7 min). The membranes were blocked with 3% nonfat milk or ECL PrimeTM blocking agent (Cytiva ...
-
bioRxiv - Biochemistry 2021Quote: B16-F1 cells and derived CapZa1/2 CRISPR#1 and CapZb KO#10 were cultured in DMEM (4.5 g/L glucose; Invitrogen, Germany), supplemented with 10% FCS (Gibco) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lysates were centrifuged at 17,000 × g for 10 min and supernatant incubated overnight at 4 °C with 2 μg of anti-PTBP1 antibody (monoclonal-ThermoFisher) or anti-FLAG antibody (monoclonal-Sigma) ...
-
bioRxiv - Immunology 2019Quote: Samples were diluted in culture medium (RPMI 1640 [Gibco, Massachusetts/USA] supplemented with 2 g of NaHCO3, 10 mL of nonessential amino acids [Gibco] ...
-
bioRxiv - Synthetic Biology 2020Quote: ... HEK293T (ATCC CRL-3216), was cultured in complete media (DMEM; 1 g/l glucose, 2 mM L-glutamine, 10 % heat-inactivated FBS (Gibco)) with 5 % CO2 at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL 0.5 µg/ µL oligo dT and 2 µL dNTP mix (10 mM stock made from individual 100 mM dNTP stocks, Invitrogen) were added to each sample followed by a 5-minute incubation at 65°C ...
-
bioRxiv - Neuroscience 2021Quote: ... we re-suspended cells in PBS/ 0.2% human serum containing 2 µg/mL 7-aminoactinomycin D (7-AAD) (Invitrogen, Cat# A1310). We carried out isotopic controls with irrelevant mouse IgG1-APC ...
-
bioRxiv - Bioengineering 2020Quote: iPSCs (DF19-19-9-11T) purchased from WiCell Technologies were maintained on vitronectin-coated plates in Essential 8 medium (E8, ThermoFisher Scientific), and passaged when the colonies reached ~75-80% confluence ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
Spatial rearrangement of the Streptomyces venezuelae linear chromosome during sporogenic developmentbioRxiv - Microbiology 2020Quote: ... The nucleoids were subsequently stained for 5 min at room temperature with 7-amino-actinomycin D (1 mg/ml 7-AAD in DMSO, Thermo Fisher Scientific) diluted 1:400 in PBS buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The qPCR reactions for the data corresponding to Figure 7 and Figure 7 – figure supplement 1 were carried out in 384-well plates on a QuantStudio™ 5 (Applied Biosystems). The thermal cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μl Dynabeads Protein G (Thermo Fisher Scientific, 10004D), and 400 μl dilution buffer (20 mM Tris-HCl pH 8.0 ...
-
SETD2 Deficiency Promotes Inflammatory Bowel Disease via Oxidative Stress and FasL-induced ApoptosisbioRxiv - Molecular Biology 2022Quote: ... 2 g of total RNA and SuperScript II (Invitrogen) were used to synthesize first-strand cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... GeneticinTM G-418 Sulphate (ThermoFisher Scientific, 108321-42-2). HEPES buffered Hanks balanced salt solution (HBSS/HEPES ...
-
bioRxiv - Microbiology 2021Quote: ... 5% CO2 in HMI-9 medium supplemented with 20% heat inactivated Foetal μg/ml streptomycin (Gibco). Cell lines were µg/ml G418 (parental ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented either with 5 gm/L AlbuMax I (for 3D7, R539T and RKL-9; Gibco, USA) or 10% heat inactivated human A+ serum (for NF54 ...
-
bioRxiv - Neuroscience 2022Quote: ... the iPSCs were subcultured in the vitronectin (Thermo Fisher)-coated 10 cm dishes with Essential 8 medium (Thermo Fisher). After reaching ∼70% confluency ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 cm dish in Essential 8 medium (Thermo Fisher Scientific) and 10 µM Rock inhibitor Y-27632 (Selleck Chem) ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 cm plates in Essential 8 (E8) medium (Fisher Scientific), which was changed daily ...
-
bioRxiv - Genetics 2023Quote: ... 10 mM Tris-HCl pH 8 (Invitrogen REF 15568-025), 5 mM Calcium Chloride (Sigma-Aldrich 21115-100ML) ...
-
bioRxiv - Neuroscience 2023Quote: ... 8-10 fields of TetraSpeck beads (100 nm; Invitrogen T7279) immobilized on coverslips coated with poly-L-lysine were imaged for 100 frames with 50 ms exposure and low laser power for determining dual-view correction.
-
bioRxiv - Cancer Biology 2023Quote: ... 8-10 μm sections on SuperFrost Plus slides (Thermo Scientific) were fixed in 1% paraformaldehyde for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Spores were incubated with 10 μM SYTO 13 Green Fluorescent Nucleic Acid Stain (Thermo Fisher Scientific) for 2 h and observed by epifluorescence microscopy ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...