Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for 6 hydroxy 2 methylquinazolin 4 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... All sections were mounted with 50μl of ProLong Gold Antifade mounting media containing a fluorescent nucleic acid dye 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, P36931) before imaging ...
-
bioRxiv - Bioengineering 2023Quote: ... These slices were then fixed in 4’,6-diamidino-2-phenylindole (DAPI) mounting media (Fluoromount-G® with DAPI, Thermo Fisher Scientific, USA), and washed twice with PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then stained with 4′,6-diamidino-2-phenylindole (DAPI) to stain cell nuclei and mounted with Immu-Mount mountant (Thermo Scientific, Cat# 9990402) onto microscope slides.
-
bioRxiv - Microbiology 2022Quote: ... and blocked for 45 min in 2% bovine serum albumin (BSA) in PBS prior to staining with DAPI (4=,6-diamidino-2-phenylindole) and mounted in Prolong Diamond antifade (Molecular Probes, Life Technologies). Images were captured using a Nikon Eclipse Ti confocal microscope (Nikon Instruments ...
-
bioRxiv - Bioengineering 2023Quote: ... for 30 seconds at room temperature followed by 15 min staining with 1 µg/mL 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, cat. no. D1306) before microscopic imaging ...
-
bioRxiv - Bioengineering 2023Quote: ... The slides were thoroughly rinsed and sealed utilizing a SlowFade Gold antifade reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) and coverslips.44 The stained slides were imaged at 4x magnification with an EVOS fluorescence imaging system.
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were rinsed three times with 1X PBS and coated with ProLong Gold antifade mounting medium with DAPI (4’,6-diamidino-2-phenylindole, 100 ng/ml) (Life Technologies, P-36931) on slides ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
DNA uptake by cell wall-deficient bacteria reveals a putative ancient macromolecule uptake mechanismbioRxiv - Microbiology 2022Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene) stock solution (Invitrogen) was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 6 using a 2 kDa MWCO dialysis unit (ThermoFisher). Heats of binding were measured using a MicroCal iTC200 calorimeter (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The staining was visualized using a microscope (Zeiss ...
-
bioRxiv - Biophysics 2022Quote: ... and 6-Dodecanoyl-2-Dimethylaminonaphthalene (Laurdan) were purchased from ThermoFisher Scientific Ltd ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) for nuclear detection (ThermoFisher MA). For live-cell imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:10000, Thermo Fisher Scientific). Semi-quantitative methods were utilized for analysis ...
-
bioRxiv - Microbiology 2024Quote: ... 6’-diamidino-2 phenylindole (DAPI; Cat. P36941, Invitrogen, Carlsbad, CA) and visualized on a Leica Stellaris confocal microscope using a 63x oil immersion objective ...
-
bioRxiv - Neuroscience 2021Quote: ... + 2% heat inactivated fetal bovine serum Certified One Shot (Gibco A38400-01) + 1× N-2 supplement ...
-
bioRxiv - Genomics 2021Quote: ... on the Ion One Touch™ 2 System (Thermo Fisher Scientific, USA). Template-positive ISPs were enriched on Ion One Touch™ ES system (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... coli One Shot ccdB Survival 2 TIR competent cells (Invitrogen, ThermoFisher Scientific) and selected on LB agar supplemented with 50 µg/mL kanamycin ...
-
bioRxiv - Biochemistry 2022Quote: ... coli One Shot ccdB Survival 2 TIR competent cells (Invitrogen, ThermoFisher Scientific) and selected on LB agar supplemented with 50 µg/mL kanamycin ...
-
bioRxiv - Microbiology 2022Quote: ... coli One Shot® ccdB SurvivalTM 2 T1R competent cells (Life Technologies), which was grown in LB agar plates (10 g l-1 NaCl ...
-
bioRxiv - Biochemistry 2024Quote: ... coli One Shot™ ccdB Survival™ 2 T1R Competent Cells (ThermoFisher). Single colonies were cultured for plasmid isolation and the cloned sequence was confirmed by DNA sequencing.
-
bioRxiv - Molecular Biology 2020Quote: ... for the first 24 hours and for further 4 to 6 days in Essential 6 media (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... and Fluo-4 AM (Invitrogen, 2 μM) probes for 30 min before fixation with 1% PFA for 4 hours ...
-
bioRxiv - Genomics 2021Quote: ... 3.5× 10−4% 2-mercaptoethanol (Gibco, 21985023), 0.12% Nicotinamide (Calbiochem ...
-
bioRxiv - Cell Biology 2024Quote: ... The electroporated cells were plated in one well of 6 well plate with StemFlex media (ThermoFisher Scientific) supplemented CloneR (Stemcell technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4’,6-diamidino-2-phenylindole (DAPI) (00-4959-52, Invitrogen, Thermo Fisher Scientific, MA, USA) as counterstaining.
-
bioRxiv - Bioengineering 2020Quote: ... the coverslips were placed upside down on a glass slide with slow fade mounting medium containing 4’,6-diamidino-2- phenylindole (DAPI, Life Technologies, Carlsbad, CA, USA) and kept at 4 °C until observation ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated with Alexa-Flour-488 or 555 secondary antibodies (1:1000) along with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, Camarillo, CA, 1:1000) for 1 hr at room temperature (RT) ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were counterstained with Hoechst 33342 DNA dye NucBlue® Live ReadyProbes® reagent for live cell imaging or 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI) and SYTO® 60 fluorescent nucleic acid stain for fixed samples (Invitrogen, Molecular Probes, Germany).
-
bioRxiv - Biochemistry 2020Quote: ... Coverslips were mounted and cells were counterstained on the glass slides using ProLong Gold with DAPI (4’, 6-diamidino-2-phenylindole) (Molecular Probes, Eugene, OR, US). Images were collected using an Axio Plan2/AxioCam microscope and image processing was performed with MrC5/Axiovision software (Zeiss ...
-
bioRxiv - Immunology 2021Quote: ... bacteria were stained with 2µg/µL of 4’,6-diamidino-2-phenylindole (DAPI) and mounted in ProLong Diamond Antifade (Life Technologies, Eugene, OR, USA; P36961). Image acquisition was performed using a Leica confocal microscope (Leica ...
-
bioRxiv - Cell Biology 2021Quote: ... One milligram of protein was incubated with 4 µg of antibody (IgG (Rb, Invitrogen) or HA (Rb ...
-
bioRxiv - Biochemistry 2022Quote: ... and blotted for 4 to 6 seconds at 4°C and 100% humidity using the Vitrobot system (ThermoFisher), before plunging immediately into liquid ethane for vitrification ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by 4–6 hr incubation with Protein G Dynabeads (Life Technologies). Beads were washed four times with 1 mL of cold radioimmunoprecipitation assay buffer (RIPA ...
-
bioRxiv - Neuroscience 2022Quote: ... The iPSCs were passaged every 4-6 days with Versene solution (Gibco) and split 1:8 to 1:10 each time ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 6 weeks-of-age was fixed in 4% paraformaldehyde (Acros Organics), cryo-preserved using 30% sucrose (Fisher) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Microbiology 2022Quote: 293T-ACE2 and HT1080-ACE2 cells were seeded in 24-well plates and 6-well plates respectively to achieve 70% confluency after 4-6 hours and then transfected with Lipofectamine RNAiMAX (Thermofisher) using the indicated dsiRNAs (IDT ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, Cat # N13195) and incubated for 30 minutes in their respective culture conditions ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells (2 × 105) were plated in 6 well culture dishes (Nunc™ ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI, 0.1 mg/ml, D1306; Molecular Probes) was added into the incubation solution to visualize cell nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µM DSM1,79 6 µM blasticidin-S (Invitrogen Life Technologies R21001), 5 nM WR99210 (Jacobus Pharmaceuticals) ...