Labshake search
Citations for Thermo Fisher :
801 - 850 of 4311 citations for 6 NITROISOCHROMAN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). In mouse samples ...
-
bioRxiv - Immunology 2023Quote: ... using a QuantStudio 6 Flex Real-time PCR system (Applied Biosystems) (Glasgow) ...
-
bioRxiv - Immunology 2023Quote: ... All culture wells were supplemented with 6 mg/ml PI (Invitrogen) and were incubated at 37°C for 40 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... together with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) diluted in 2% BSA in PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transfections were conducted in 6-well format using Lipofectamine 3000 (ThermoFisher). 200 ng of reporter plasmid were co-transfected into 3T3-immortalized ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, #D1306, 1/1000) were incubated overnight at 4°C in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). The Tbp mRNA was used as a loading control ...
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions were run in a QuantStudio 6 Flex (Thermo Fisher) with a 95°C hold followed by 40 cycles of 95°C for 15s ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Physiology 2023Quote: ... Organs were then embedded in 6% agarose low melting gel (Invitrogen), and organ sections (100 μm ...
-
bioRxiv - Genetics 2023Quote: ... The protein complexes were resolved on 6% DNA retardation gels (Invitrogen) for 1 h at 100 V ...
-
bioRxiv - Immunology 2023Quote: ... Bone marrow was seeded at 1x10^6 in RPMI (Gibco,11875119)+10%FBS containing 20ng/mL of recombinant GM-CSF (PreproTech ...
-
bioRxiv - Genomics 2023Quote: ... we coated fresh 6-well plates (Thermo Fisher Scientific, cat# 140675) or/and 12-well plates (Corning ...
-
bioRxiv - Immunology 2023Quote: ... IL-6 (10 ng/ml; Thermo Fisher Scientific, Waltham, MA, USA), IL-21 (50 ng/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Life Technologies) using forward and reverse primers (NOTCH3-F CGTGGCTTCTTTCTACTGTGC ...
-
bioRxiv - Physiology 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole) (D1306) was purchased from Invitrogen. XMU-MP1 (#22083 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were -treated using 6 U of Turbo DNase (ThermoFisher, UK) at 37°C for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... anti-Integrin alfa-6 (ITGA6) (1:1000) (MA5-16884, ThermoFisher Scientific) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... were coated with IL-6 capture antibody (ThermoFisher Scientific, MP5-20F3) and left overnight at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... or with Cultrex SCQ (Bio-techne) coated 6 well plates (Nunc). Cells were passaged as small clumps every 4 to 5 days with Dispase (Gibco) ...
-
bioRxiv - Genetics 2023Quote: ... and the homozygote variant iPSCs were grown in a feeder-free manner on Matrigel (Corning)-coated 6-well plates in Essential 8 (E8) medium (ThermoFisher Scientific). Media was changed daily ...
-
bioRxiv - Genomics 2023Quote: ... with specific primers on a QuantStudio 6 Flex instrument (Applied Biosystems). mRNA expression was normalized to the housekeeping gene Ppib for all samples ...
-
bioRxiv - Immunology 2023Quote: ... qPCR analysis was conducted on a QuantStudio 6 (Thermo Scientific, USA) using TaqPath master mix (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and 1.8% sodium chloride (Fisher Scientific, ACS Cas.# 7647-14-6). After 20 minutes undisturbed ...
-
bioRxiv - Molecular Biology 2023Quote: ... The amplified DNA was separated by using 6% TBE gels (Invitrogen) and imaged.
-
bioRxiv - Biophysics 2023Quote: ... using the QuantiStudio 6 Flex system (Applied Biosystems: Waltham, MA, USA). Gene expression was analyzed using the ΔΔCT method ...
-
bioRxiv - Genetics 2023Quote: ... along with 6 µL of PageRuler Plus Prestained Protein Ladder (ThermoFisher) as standard and electrophoresed at 170 V using the Mini Trans-Blot cell system (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... or 6 was then used to transform into stbl3 strain (Invitrogen) for further plasmid amplification.
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Genomics 2024Quote: Agarose (Fisher Bioreagents/Thermo Fisher Scientific, cat. no. 9012-36-6)
-
bioRxiv - Molecular Biology 2023Quote: ... for 6 hours in less serum optiMEM media (Thermofisher, cat 31985062). Then ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA was either eluted in 6 µl nuclease-free water (Invitrogen) and transformed into electrocompetent E ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...
-
bioRxiv - Zoology 2024Quote: Larval settlement assays were carried out in 6-well plates (ThermoFisher Scientific 130184 BioLite 6 well multidish ...
-
bioRxiv - Physiology 2024Quote: ... in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). The Rplp0 mRNA was used as a loading control ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4′,6-diamidino-2-phenylindole (DAPI) was acquired from Invitrogen, Thermofisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... The desired DNA product was purified with 6% TBE gel (Invitrogen) and subjected to massive parallel amplicon sequencing carried out by an Illumina sequencer (Sanger/Illumina 1.9) ...
-
bioRxiv - Genomics 2024Quote: ... Reactions were loaded onto 6% TBE retardation gels (Thermo Fisher Scientific) and run in 0.5× Tris–borate–EDTA buffer for one hour ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) or propidium iodide (PI ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were labeled with DAPI (4’,6-diamidino-phenylindole, Invitrogen) and subsequently mounted onto a glass slide and cover-slipped using an antifade mounting medium.
-
bioRxiv - Neuroscience 2023Quote: ... All experiments were carried out with QuantStudio 6 Flex (Applied Biosystems). SYBR was used as a reporter and ROX was used as a passive reference according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2024Quote: ... Magnesium chloride (7791-18-6-500G) was obtained from ACROS Organics. 8 well-chambered cover glasses (Sterile ...
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... QuantStudio™ 6 flex Real-Time PCR System (Applied Biosystems: 4485691).
-
bioRxiv - Cancer Biology 2024Quote: ... in triplicates in 6-well plates using Lipofectamine RNAiMax reagent (Invitrogen) according to manufacturer’s instructions (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... and cultivated for 6 days in RPMI1640/GlutaMax (ThermoFisher Scientific; 61870036) medium supplemented with 10 % FBS (EMD Millipore TMS-013-B ...
-
bioRxiv - Biophysics 2024Quote: ... oocytes were labeled with tetramethylrhodamine-6-maleimide (TMRM, Invitrogen or Abcam) at a final concentration of 25 µM and the cells were left in the dark on ice for 20 minutes ...