Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for 6 Cyclopentadecen 1 one 3 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... One mL of TRIzol Reagent (ThermoFisher 15596018) was added to the lysate ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A NanoDrop One spectrophotometer (Thermo Fisher Scientific) was used to determine RNA concentration and quality ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A NanoDrop One spectrophotometer (Thermo Fisher Scientific) was used to determine RNA concentration and quality ...
-
bioRxiv - Neuroscience 2022Quote: ... 1X Culture One Supplement (Thermo Fisher Scientific), 1 µg/mL Laminin (R&D) ...
-
bioRxiv - Biochemistry 2022Quote: ... one stained with an anti-METTL7B (Invitrogen, Carlsbad ...
-
bioRxiv - Neuroscience 2019Quote: ... and 1x Culture One (Gibco A33202-01) in Neurobasal-A (Gibco 12349-015)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... one for Gelcode staining (Thermo Fisher Scientific), and the other Western blot analysis to locate the membrane protein band by streptavidin-conjugated with horseradish peroxidase (HRP ...
-
bioRxiv - Microbiology 2021Quote: ... one stored in RNALater (Thermo Fisher Scientific) for RNA extraction and quantification of gene expression by RTqPCR and RNA-Seq ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the following ones from Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... on the Step One Plus (ThermoFisher Scientific) or on the BioRAD CFX96 Real Time PCR system (Biorad) ...
-
bioRxiv - Neuroscience 2020Quote: ... One drop of NucBlue (Thermo Fisher Scientific) was added to the cell suspension and allowed to sit for 20 minutes (to aid in sorting and cell quantification) ...
-
bioRxiv - Biochemistry 2021Quote: One ShotTM Stbl3 (Fisher Scientific, Cat. # C737303)
-
bioRxiv - Cell Biology 2021Quote: ... and a NanoDrop One spectrophometer (ThermoFisher Scientific).
-
bioRxiv - Genomics 2021Quote: ... and quantified using NanoDrop One (Thermo Scientific). The RNA was serially diluted from 1011 to 104 cp/μL and used as input into the detection reaction ...
-
bioRxiv - Microbiology 2020Quote: ... coli One Shot PIR2 cells (Thermo Fisher), expressing λ pir ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... quantified by NanoDrop One (Thermo Fisher Scientific), and vacuum dried ...
-
bioRxiv - Microbiology 2022Quote: ... and ABI Step One system (Applied Biosystems) were used for quantitative RT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... one protease inhibitor mini-tablet (Thermo Scientific) and Benzonase nuclease (Millipore) ...
-
bioRxiv - Cancer Biology 2022Quote: ... An UltraVision ONE Detection System (Thermo Fisher) was used following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: ... in Step-One plus from Applied Biosystems. gyrA was used as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... PichiaPink™ yeast strain one (Invitrogen, USA) was grown according to the instructions of the manufacturer ...
-
Glutamine synthetase mRNA releases sRNA from its 3’UTR to regulate carbon/nitrogen metabolic balancebioRxiv - Microbiology 2022Quote: ... RNA was quantified using NanoDrop One (Invitrogen). Total RNA (5 µg ...
-
bioRxiv - Genomics 2022Quote: ... A NanoDrop One (ThermoFisher Scientific, Waltham MA) spectrophotometer was used to quantify the genomic DNA and determine 260/280 and 260/230 nm ratios ...
-
bioRxiv - Microbiology 2022Quote: ... coli DH5α One Shot Top10 cells (Invitrogen). Transformants were selected based on Zeocin resistance (25 μg mL−1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1x Culture One (Gibco, #A33202-01) in Neurobasal-A (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... coli One Shot BL21 (DE3) (Life Technologies). The ARH1 D55,56A ...
-
bioRxiv - Plant Biology 2022Quote: ... a NanoDrop One spectrophotometer (Thermo Fisher Scientific) and Qubit 3.0 Fluorometer (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... One Shot BL21(DE3) (Invitrogen, 44-0184), OverExpress C43 (DE3 ...
-
bioRxiv - Genetics 2023Quote: ... and quantified with NanoDrop One (Thermo Fisher). One μg of the DNA was used as template for dsRNA synthesis using MEGAscript T7 Transcription kit (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... coli strain One Shot™ TOP10 (Invitrogen) for plasmid amplification or BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... One Shot competent cells (Thermo Fisher Scientific) were transformed and candidate colonies were verified by diagnostic digestion ...
-
bioRxiv - Genetics 2023Quote: ... transformation was performed (One Shot Stbl3, Invitrogen). The inserted gRNA sequences were confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... with One Shot™ TOP10 (ThermoFisher Scientific) for allele-specific sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... and one µL GlycoBlue (Fisher Scientific, #AM9515) was added to seventy µL of the extracted aqueous phase ...
-
bioRxiv - Microbiology 2023Quote: ... SuperScript IV One Step RT-PCR (Invitrogen) and the forward primer 5’ TGGAACGTTGACCTGAGAGA 3’ and reverse primer 5’ AAGGATACGGTCCGTTCTGA 3’ were used to amplify a missing 689 bp section between the L1 and E6 genes ...
-
bioRxiv - Genomics 2023Quote: ... A NanoDrop One spectrophotometer (Thermo Fisher Scientific) was used to determine RNA concentration and quality ...
-
bioRxiv - Genetics 2023Quote: ... and quantified using Nanodrop One (Thermo Scientific). 100 nanograms for each of the three replicates from every sample were then used as a starting material to generate RNA-seq libraries following the Universal RNA-seq with NuQuant protocol (Tecan) ...
-
bioRxiv - Neuroscience 2024Quote: ... One µl of GlycoBlue co-precipitate (Invitrogen) was added to each sample and mixed well before the addition of 250 µl of isoproponol ...
-
bioRxiv - Developmental Biology 2024Quote: ... using a NanoDrop One Spectrophotometer (ThermoFisher Scientific). Equal amounts of protein (0.25 µg ...
-
bioRxiv - Immunology 2022Quote: ... and 0.75% w/v 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) in a hydrated 10K molecular weight cutoff dialysis cassette (Thermo Scientific). S ‘2P’ and HexaPro IMAC elution fractions were concentrated to ∼ 1 mg/mL and dialyzed three times into 50 mM Tris pH 8 ...
-
bioRxiv - Immunology 2020Quote: ... and 0.75% w/v 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) in a hydrated 10K molecular weight cutoff dialysis cassette (Thermo Scientific). S-2P IMAC elution fractions were concentrated to ~1 mg/mL and dialyzed three times into 50 mM Tris pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pierce premium grade N-hydroxysulfosuccinimide (sulfo-NHS, PG82071) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 22980) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products (1□μg) of desired templates were 3’ end-labeled using a Pierce biotin 3’ End DNA Labeling Kit (Thermo Scientific). The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA) ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... cells were blocked for 1 h in 3% BSA/PBS and incubated with rabbit-anti-GFP (1:50 in 3%BSA/PBS, 200 µl/well, Invitrogen, G10362) for 1 h at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... viable CD45-CD34+Sca-I- cells were sorted from epidermal single cell suspensions of 1-month-old EGFRΔEgr2 (n=3) and littermate controls (n=3) into Trizol LS Reagent (Thermo Fisher Scientific) using a FACS Aria III ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmids (1 μg of guide RNAs +/- 3 μg donor) were diluted in 1 ml OptiMem (Gibco) and 20 ul PEI (1 mg/ml) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Undigested and digested products were resolved in a 3% Metaphor 1:1 (lonza)/agarose gel (Invitrogen) gel ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific) (caspase 3/7 lysis buffer ...