Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for 6 Chloropyrazolo 1 5 a pyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA) staining solution and mounted with cover glass ...
-
bioRxiv - Microbiology 2022Quote: ... and 4’,6-diamidino-2-phenylindole counterstain (DAPI, Thermo Fisher Scientific) in antibody buffer at room temperature for one hour ...
-
bioRxiv - Microbiology 2022Quote: ... and mounted with ProLong Diamond + 4’,6-diamidino-2-phenylindole (Invitrogen). Imaging was performed on a Zeiss 880 laser scanning confocal microscope ...
-
bioRxiv - Microbiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) antifade reagent (Life Technologies, CA, USA) and sealed with nail polish.
-
bioRxiv - Pathology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA), mounted ...
-
bioRxiv - Pathology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA), mounted ...
-
bioRxiv - Bioengineering 2023Quote: ... together with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) diluted in 2% BSA in PBS ...
-
bioRxiv - Physiology 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole) (D1306) was purchased from Invitrogen. XMU-MP1 (#22083 ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4′,6-diamidino-2-phenylindole (DAPI) was acquired from Invitrogen, Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) or propidium iodide (PI ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Neuroscience 2020Quote: ... claudin-5 (1 μg/ml) and occludin (2 μg/ml; all from Thermo Fisher Scientific). After incubation with primary antibodies membrane was washed with PBS-T three times on a platform rocker and incubated with horseradish peroxidase-conjugated secondary antibody diluted in PBS-T 1:2000 (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recovered nuclei were stained with FITC-conujugated α-5-bromo-2’-deoxyurine (Invitrogen, MoBu-1) in staining buffer (2 mM HEPES pH 7.4 ...
-
bioRxiv - Developmental Biology 2023Quote: Tadpoles were immersed in a solution containing 1 mM EdU (5-ethynyl-2’-deoxyuridine; Invitrogen) before fixation ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Cell Biology 2022Quote: ... DNP (EM 1:6-1:30, #71-3500, Invitrogen), DPP4 (IF/FACS 1:100 ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl cDNA (diluted 1:20) was used in a 6 µl Fast SYBR Green qPCR reaction (ThermoFisher Scientific). No-template controls for each gene were run in all qPCR plates ...
-
bioRxiv - Microbiology 2020Quote: ... Finally samples were counter stained for nucleus with 1 μM DAPI (4′, 6-diamidino-2′-phenylindoldihydrochloride; Thermo Fisher Scientific). Zeiss inverted Axio Observer fluorescent microscope (Zeiss ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Chromosomes were counterstained for 20 minutes with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; ThermoFisher Scientific, D3571) in 2x SSC ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Plant Biology 2024Quote: DAPI (4′,6-diamidino-2-phenylindole) solution: Dilute 1 mg/ml DAPI (ThermoFisher, Cat. No. 62248, Rockford, IL, USA) to a final concentration of 0.5 µg/ml in 1x PBST (0.1% Tween-20).
-
bioRxiv - Physiology 2023Quote: ... the sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI; D1306, Thermo Fisher Scientific; 1:1000 in PBS) for 2min at room temperature to counterstain the nucleus before being washed twice in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:2000 LipidTOX was added along with 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) for 15 min ...
-
Controlled Fluorescent Labelling of Metal Oxide Nanoparticles for Artefact-free Live Cell MicroscopybioRxiv - Biophysics 2021Quote: ... 1% NEAA (non-essential amino acids, Gibco) in an incubator at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% non-essential amino acids (Life Technologies), and 0.2% penicillin-streptomycin solution (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% MEM non-essential-amino-acids (Gibco) and 1 µg/ml heparin (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM non-essential amino acids (Gibco), 100 units/ml human LIF supplemented with 10% fetal bovine serum (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% MEM non-essential amino acids (Gibco), 1% GlutaMax (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% non-essential amino acids (NEAA, Invitrogen) and 1000 U/mL LIF (ESGRO ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1× non-essential amino acids (both Gibco) and 100 U ml-1 penicillin and 100 µg ml-1 streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2020Quote: ... 1% non-essential amino acids (NEAA; Gibco) and 1% Penicillin-streptomycin (pen-strep ...
-
bioRxiv - Cell Biology 2019Quote: ... 1× MEM nonessential amino acids solution (Gibco), penicillin (40 U/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1% MEM Non-Essential Amino Acids (Gibco), and 1% pyruvate (Gibco) ...
-
bioRxiv - Genetics 2019Quote: ... 1 mM nonessential amino acids (Life Technologies), 10 ng/ml glial cell line-derived neurotrophic factor (GDNF ...
-
bioRxiv - Immunology 2021Quote: ... 1% MEM non-essential amino acids (Gibco), 1% sodium-pyruvate (Corning) ...
-
bioRxiv - Microbiology 2021Quote: ... 1% non-essential amino acids (Life Technologies), 100 U/mL penicillin ...
-
bioRxiv - Microbiology 2021Quote: ... 1× non-essential amino acids (NEAA; Gibco), 1× penicillin-streptomycin (P/S ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM non-essential amino acids (Gibco), 1X GlutaMAX and 0.1 mM b-mercaptoethanol ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM non-essential amino acids (GIBCO) and 2% Penicillin Streptomycin (GIBCO).
-
bioRxiv - Cell Biology 2021Quote: ... in 1% formic acid (Thermo Fisher Scientific) and the supernatants were collected ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% non-essential amino acids (ThermoFisher Scientific) and 1% Pen/Strep (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1 mM nonessential amid acids (Gibco) in 6-well plates until sub-confluent ...