Labshake search
Citations for Thermo Fisher :
8201 - 8250 of 10000+ citations for 7 METHOXY 4 4 DIMETHYL 3 4 DIHYDRO 2H NAPHTHALEN 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... lysates were incubated overnight at 4 °C with Pierce Streptavidin Magnetic Beads (Thermo Scientific, Catalog Number 88816) which were washed beforehand with RIPA Lysis Buffer (50 mM Tris pH 8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 μl of 4 × 104 cells/ml HEK293 Flp-In T-REx cells (Thermo Fisher Scientific, R78007) or HEK293 Flp-In T-REx SBP-eIF4A1 (Phe163Leu-Ile199Met ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) NucBlue (Cat. #: R37606; Thermo Fisher Scientific). Slides were mounted using Aqua-Poly/Mount (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by 2 hour incubation at 4℃ with 50 µL of magnetic Dynabeads Protein G (Invitrogen, #10004D). Beads were washed with 1x TBS Tween-20 washing buffer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... An equal amount of protein (20 µg) was separate on 4%-12% bis-tris polyacrylamide gel (Invitrogen,) in MOPS running buffer (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were boiled for 5 min prior to loading onto NuPAGE 4-12% Bis-Tris gels (Invitrogen). After washing with water and then with 5% glycerol ...
-
bioRxiv - Cell Biology 2023Quote: ... The reaction was stopped (15 mins on ice) using 4 mM phenylmethylsulfonyl fluoride (PMSF; Thermo Fisher Scientific).
-
bioRxiv - Biochemistry 2023Quote: ... and 2mM DTT) for 30 min at 4 °C and analyzed on 6% TBE gels (Life Technologies) at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... MOI of 4) was fragmented for 10 min at 70°C with RNA fragmentation reagent (Thermo Fisher). After fragmentation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 ug of the boiled samples were loaded onto a NuPAGE 4-12% BisTris gel (Invitrogen, WG1402BOX) and afterwards transferred to nitrocellulose using the Trans-Blot Turbo system (BioRad ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 175 V) on a gradient Bis-Tris SDS-PAGE gel (4-12%, NuPAGE; Thermo Fisher, Carlsbad, CA) and transferred (90 min ...
-
bioRxiv - Microbiology 2023Quote: ... Vero E6-TMPRSS2 cells were fixed with 4% paraformaldehyde and stained with anti-N (Invitrogen; MA1-7403). The number of fluorescent foci was measured using a Cytation 5 Cell Imaging Multimode Reader (BioTeK).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: hiPSC-CM were loaded with a calcium indicator dye (10 μM Fluo 4-AM, Thermo Fisher Scientific) or a potentiometric dye (1:1000 FluoVolt ...
-
bioRxiv - Neuroscience 2023Quote: ... third instar larval brains were dissected in PBS and fixed in 4% formaldehyde (FA) (Thermo Scientific, 28908) in phosphate buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... An equal amount of protein (20 µg) was separated on 4%-12% bis-tris polyacrylamide gel (Invitrogen,) in MOPS running buffer (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... 30 µg of protein lysate supernatants were run on a Bolt BT Plus 4–12% gel (Invitrogen) and transferred onto PVDF membranes at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... 50 mM DTT and loaded onto NuPAGETM 4-12% Bis-Tris precast polyacrylamide gels (Thermo Fisher Scientific) with the volume of each sample adjusted to ensure equal protein amounts per well ...
-
bioRxiv - Immunology 2023Quote: ... and incubated for 4 hours at RT with a goat anti-rat-AF647 secondary antibody (polyclonal, Invitrogen). After secondary antibody ...
-
bioRxiv - Immunology 2023Quote: ... DNA concentrations were quantified with a Qubit 4 Fluorometer using the Qubit dsDNA high sensitivity assay (Invitrogen). Sequencing of the TCRβ and IGH CDR3 regions was performed using the immunoSEQ platform (Adaptive Biotechnologies).76,77 TCRβ and IGH repertoire data were downloaded from the Adaptive ImmunoSEQ analyzer web interface after filtering to remove non-productive reads ...
-
bioRxiv - Microbiology 2023Quote: ... The fixed cells were then stained with 4 µM Hoechst 33342 (cat. no. 62249, Thermo Fisher Scientific) at room temperature for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... 40 µg of total RNA was treated with 4 U of TURBO™ DNase (Ambion, Catalog #: AM2238) at room temperature for 45 min followed by a boost with 4 U and an additional 45 min incubation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Blocked and rinsed membranes were incubated overnight at 4°C with INO80E Polyclonal Antibody (Invitrogen, ThermoFisher Scientific) at concentration 0.04 µg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... Blocked and rinsed membranes were incubated overnight at 4°C with INO80E Polyclonal Antibody (Invitrogen, ThermoFisher Scientific) at concentration 0.04 µg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... lysates were incubated for 1hour at 4 °C with His-Pure Cobalt Purification beads (Thermo Fisher Scientific). After incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... Tissue slabs were then stored in 100% methanol (MeOH; Cat. No. 67-89-4; Fisher Scientific, Sweden) at −20 °C until further processing.
-
bioRxiv - Developmental Biology 2023Quote: ... lysates were loaded (7.5-20 µg protein) onto a 4-12% NuPAGE Bis-Tris gel (Thermo Fisher). Protein lysates were reduced with NuPAGE LDS sample buffer (4x ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates of (20-30 μg of protein) were separated on NuPAGE 4-12% Bis-Tris gels (Invitrogen) under reducing conditions and transferred to PVDF membranes (Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media were then removed and cells fixed with 4% formaldehyde for colorimetric crystal violet assay (Thermofisher Scientific). For proliferation assays ...
-
bioRxiv - Bioengineering 2023Quote: ... mCherry and eGFP expression was visualized using a 4-channel EVOS M5000 fluorescence microscope (Thermo Fisher Scientific). Cells were harvested by trypsinization ...
-
bioRxiv - Cancer Biology 2023Quote: ... then 5 × 107 cells were lysed in 4 ml Pierce IP Lysis Buffer (87788; Thermo Fisher Scientific) for 20 minutes on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... enzymatic reactions were boiled with laemmli buffer and then run on 4-12% NuPage BisTris gels (Invitrogen) and blotted as described previously ...
-
bioRxiv - Biophysics 2023Quote: ... Cell nuclei were stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml; Molecular Probes). Stained sections were imaged using epifluorescence and deconvolution epifluorescence microscopy on an Olympus IX83 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on a Nu-PAGE 4-12% Bis-Tris Protein Gel (Thermo Fisher Scientific, NP0335BOX), transferred to a 0.45 μm nitrocellulose membrane (GE Healthcare Life Science ...
-
bioRxiv - Neuroscience 2023Quote: ... and loaded on 4 – 12% Bis-Tris ZOOM SDS-PAGE pre-cast gels (cat. # NP0330BOX, Life Technologies). For the second dimension ...
-
bioRxiv - Microbiology 2023Quote: ... The quality of the libraries was validated by Qubit 4 fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). Sequencing was performed on Nextseq 550/1000 (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... incubation at 4 °C overnight with the HA monoclonal antibody (Alexa Fluor™ 555, Invitrogen # 26183-A555). After 3 PBS washes and 0.1% DAPI staining ...
-
bioRxiv - Cancer Biology 2024Quote: ... Whole-cell lysates were separated by either 12.5% or 4-12% SDS-PAGE Bis-Tris gels (Invitrogen) and transferred to a 0.45 um PVDF membrane overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Indicated amounts of protein were loaded on Nu-Page 4-12% bis-tris gels (Thermo Fisher Scientific), separated by SDS-PAGE ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4µM Fluo-4 AM in Hanks Balanced Salt Solution containing calcium (HBSS+Ca2+, Gibco, Cat#14025-092) for 30 minutes and then washed out and imaged with HBSS+Ca2+ ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were washed twice with DPBS and incubated with paraformaldehyde (PFA, 4% vol/vol, ThermoFisher #28908) diluted in DPBS for 10 minutes (Transwell and intestine-on-chip systems ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples (20 µg) were separated on a 4% to 12% Bis-Tris Plus gel (Thermo Fisher Scientific) and then transferred onto a polyvinylidene difluoride membrane (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2024Quote: ... Sections were stained with DAPI (4 ',6' -diamidino-2-phenylindole) and mounted in Prolong Gold (Life Technologies). Imaging was performed on a Nikon Eclipse Ti Confocal at 20X objective and processed using Nikon Elements-AR ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were boiled for 5 minutes before loading duplicate 4-12% Bis-Tris SDS-PAGE gels (ThermoFisher) and running gel electrophoresis (1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... The precipitated proteins were separated by NuPAGE® Novex® 4–12% Bis-Tris gels (NP0322BOX, Invitrogen). In-gel digestion with trypsin (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: MOLT-4 cells expressing HiBiT-tagged CDK9 were cultured in RPMI 1640 medium (Thermo Fisher Scientific, 11875093) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA samples were then treated with 4-6 units of Turbo DNase (Thermo Fisher Scientific, cat# AM2238) at 37 °C for 30 min to remove the bulk of plasmid DNA contamination ...
-
bioRxiv - Cell Biology 2024Quote: Samples from lysate or co-immunoprecipitation were loaded on a 4-12% BisTris NuPage gel (Thermo Fisher) and ran at 180 V for 60 minutes in 1x MOPS buffer (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... while the other half was fixed in 4% paraformaldehyde (PFA) in PBS (Thermo Fisher Scientific, Waltham, MA) for 24hr at 4°C for immunohistochemical analysis.
-
bioRxiv - Cancer Biology 2024Quote: ... then cells were fixed with 4% formalin solution (neutrally buffered) and kept in PBS (no. 10010023, Gibco) during the experiment ...
-
bioRxiv - Cell Biology 2024Quote: ... the double-stranded DNA probe with 4 telomeric repeats were synthesized as two single-stranded oligonucleotides (Invitrogen). Oligo 1 - 5’- GTACCCGGGGATCGTCGACTCTAGAGGGGCCCTAACCCTAACCCTAACCCTAACCCGGGCT CGAATTCGATCCTCTAGAGTCGACCTGCAGGCATGCA-3’ ...