Labshake search
Citations for Thermo Fisher :
8201 - 8250 of 10000+ citations for 6 THIOPHEN 2 YL 1H INDAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... ERCC synthetic spike-in 1 or 2 (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2 mM phenylmethylsulfonyl fluoride (PMSF; Thermo Fisher Scientific, 36978), was added to the cell monolayer at a density of 1 x 106 cells/mL ...
-
bioRxiv - Systems Biology 2022Quote: ... ERCC synthetic spike-in 1 or 2 (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Immunology 2022Quote: ... and anti-CD28 antibody (2 µg/mL; Thermo Fisher) for T cell activation for 72 h at 37°C incubator ...
-
bioRxiv - Genetics 2022Quote: ... and 2% B27 50X with vitamin A (Life Technologies) supplemented with 2 µM Thiazovivin and plated at a density of 6,000 cells per well in a Matrigel-coated 384-well plate ...
-
bioRxiv - Genetics 2022Quote: ... Cells were resuspended in RPMI with 2% KOSR (Gibco) and 2% B27 50X with vitamin A (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 μm particle size PepMap C18 column (Thermo Fisher). The gradient was 3-10% B over 10 mins ...
-
bioRxiv - Biophysics 2022Quote: ... 2% [v/v] GlutaMAX (Thermo Fisher Scientific; Cat#: 35050061), 1% [v/v] Pen/Strep (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% N-2 Supplement (Thermo Scientific cat#17502-048), 1% B-27 Supplement (Thermo Scientific cat#17504044) ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed for 10min in 2% paraformaldehyde (Fisher Scientific, USA) at room temperature and blocked with 1% BSA (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were separated on 2% agarose gel (Invitrogen), stained with ethidium bromide ...
-
bioRxiv - Microbiology 2019Quote: ... extracted RNAs were treated with 2 μ1 TurboDNasel (Invitrogen) for 15 min at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... washed × 2 using ice-cold serum-free RPMI (Invitrogen, Fisher Scientific UK Ltd ...
-
bioRxiv - Developmental Biology 2019Quote: ... and for scrambled 2 was GAGTTAGATTAGTTGTTGCGTAAGT (Stealth RNAi, ThermoFisher). Knockdown was confirmed using qPCR and primers to Satb2-lncRNA (tgatcaAGACCGGTTCTGGAGAGAAAG ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... After 2 washes in complete medium (RPMI 1640 (Gibco) with 5% sodium pyruvate ...
-
bioRxiv - Biochemistry 2019Quote: ... and detected with ECL-2 reagent (Thermo Fisher Scientific). Primary antibodies used in this study were anti-CD9 #13174S (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hoechst 33345 (2 μg/mL; Molecular Probes; #H1399) made up in blocking solution for 50 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... treated with 2 μM of Calcein AM (ThermoFisher Scientific), and visualized by epifluorescence microscopy ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 mM L-glutamine (Invitrogen Life Technologies, Paisley, UK), 1% non-essential amino acids (NEAA) ...
-
bioRxiv - Neuroscience 2019Quote: ... 0.25 mM pyruvate and 2% B27 supplement (Life Technologies). Cells were incubated at 37°C in a humidified 5% CO2-containing atmosphere ...
-
bioRxiv - Neuroscience 2019Quote: ... 0.25 mM pyruvate and 2% B27 supplement (Life Technologies) minus antioxidants (MAO ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 mM glutamine (catalog no. 2503008; Life Technologies Australia), and 50 U/mL penicillin-streptomycin (catalog no ...
-
bioRxiv - Developmental Biology 2019Quote: ... the differentiation media was supplemented with 2% B27 (Gibco), 20 ng/ml BMP4 and 10 ng/ml FGF ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 2% heat-inactivated bovine serum (HIBS, Gibco). Spleens were dissociated by crushing followed by trituration ...
-
bioRxiv - Microbiology 2019Quote: ... we visualize libraries on 2% agarose E-Gel (ThermoFisher) and determine the relative amplification success at the expected ~627 bp band size (amplicon + spacer + all primer sequences + linker) ...
-
bioRxiv - Molecular Biology 2020Quote: ... media containing 2% B27 supplement (w/o insulin, Gibco), and additional recombinant factors including Activin A (100ng/ml ...
-
bioRxiv - Developmental Biology 2020Quote: 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen A10044, Carlsbad, CA) dissolved in PBS was administered to mice at indicated postnatal days ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 2-10% fetal bovine serum (FBS, ThermoFisher), non-essential amino acid ...
-
bioRxiv - Bioengineering 2019Quote: ... L-Glutamine (100x) (2 mM; Gibco-BRL Life Technologies), penicillin (20 U ml−1) ...
-
bioRxiv - Bioengineering 2019Quote: ... L-Glutamine (100x) (2 mM; Gibco-BRL Life Technologies), penicillin (20 U ml−1) ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells (ATCC CCL-2) and HEK293-FT (ThermoFisher) were cultured at 37 °C in 5% CO2 in medium composed of high glucose Dulbecco’s modified eagles medium (DMEM ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μm Acclaim PepMap reverse phase column (Thermo Scientific) using an UltiMate 3000 RSLCnano HPLC (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 2 mmol/L L-glutamine (Thermo Fisher Scientific) (complete DMEM) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% B27 Supplement (50X) minus Vitamin A (12587010, Gibco), 1% Glutamax (35050061 ...
-
bioRxiv - Neuroscience 2021Quote: ... flash frozen in 2-methylbutane (Fisher Scientific, 03551-4), and kept at −80°C until sliced on a cryostat (Leica ...
-
bioRxiv - Microbiology 2021Quote: ... in combination with 2 μl Lipofectamine RNAi Max (ThermoFisher). 24 hours post transfection ...
-
bioRxiv - Genomics 2020Quote: ... the medium was supplemented with 2% FBS (Thermofisher, #10082147). Subsequently ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Biophysics 2020Quote: ... Samples were treated with 2 U Turbo DNase (Ambion) and purified on polyacrylamide gel (6% acrylamide:bisacrylamide 19:1 ...
-
bioRxiv - Pathology 2020Quote: ... 2 mM L-Glutamine (Thermo Scientific, Waltham, Massachussets, US), and 10% of fetal calf serum (Biowest ...
-
bioRxiv - Synthetic Biology 2021Quote: ... supplemented with 2 mM L-glutamine (Gibco, 25030-024), 50 U/ml penicillin/streptomycin (Gibco ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μL 20 mg/mL glycogen (Thermo Fisher Scientific), 10 μL 8 M LiCl ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 2 µl 10 mM dNTP stock solution (Thermo Scientific) added ...
-
bioRxiv - Cancer Biology 2019Quote: ... HUDEP-2 cells were cultured in IMDM (Thermo Fisher) supplemented with 2% FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... B27 2% (Thermo Fisher Scientific, cat. no. 17504-044), N-acetylcysteine 1.25 mM (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... 2% B27 supplement without vitamin A (Gibco, #12587‒010), and 20 U / ml DNAse (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 2% heat-inactivated FBS (Gibco, Thermo Fisher Scientific) and the embryos were immediately dissected and processed for scRNA-seq ...
-
bioRxiv - Microbiology 2020Quote: ... which was supplemented with 2% β-mercaptoethanol (Fisher Scientific). The samples were heated at 90°C for 10 minutes and loaded onto a 4-20% precast polyacrylamide gel (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... then labeled with 2 μ⍰ calcein-AM (Life Technologies) in serum-free DMEM for 20 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM L-glutamine (Thermo Fisher Scientific, Waltham, MA), 50 U/mL penicillin (Thermo Fisher Scientific) ...