Labshake search
Citations for Thermo Fisher :
8201 - 8250 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM dithiothreitol (Invitrogen), 500 nM FSE primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMax (Gibco), 5 mL non-essential amino acids (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5% goat serum (Gibco), and 0.5% Triton X-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% FBS (Gibco) and 1% glutamine ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% mouse serum (Invitrogen) and 5% rat serum (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... analyzed on a QuantStudio 3 (Applied Biosystems) thermal cycler using the standard cycling conditions ...
-
bioRxiv - Biophysics 2021Quote: ... supplemented with 3 mM L-glutamine (Gibco), 0.25 mg/mL gentamycin (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3% O2 in DMEM/F12 (Gibco) with B27 supplement (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... then 3-mm glass beads (Fisher Scientific) and 1 ml fecal lysis buffer (50 mM Tris pH7.6 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 % goat serum (with 0.02 % NaN3) (Invitrogen), 3 % donkey serum (Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... and run on a QuantStudio 3 (ThermoFisher). All reactions were normalized to the housekeeping gene RpL32 and control flies ...
-
bioRxiv - Molecular Biology 2021Quote: ... on a Quant studio 3 (Applied Biosystems) Real-Time PCR Detection machine ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-8% Tris-Acetate gels (Invitrogen EA0375) were used to resolve all proteins ...
-
bioRxiv - Developmental Biology 2022Quote: ... To-Pro-3 (1:500, Invitrogen T3605). Secondary antibodies were obtained from Jackson ImmunoResearch or Invitrogen and used at 1:200.
-
bioRxiv - Genomics 2020Quote: ... and 3 μl T4 DNA ligase (Invitrogen). All reactions were performed in LoBind tubes ...
-
bioRxiv - Neuroscience 2020Quote: ... TOTO-3 (Thermo Fisher Scientific, Cat#: T3604) or DAPI (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... 100 mM NaCl (Fisher Scientific S271-3), 50 mM Tris pH 7.5 (Life technologies AM9855) ...
-
bioRxiv - Genomics 2021Quote: ... on a QuantStudio 3 cycler (Applied Biosystems, Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... using qPCR (QuantStudio 3 cycler, Applied Biosystems, Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... with 3 mM AlexaFluor 647-azide (ThermoFisher). After another quick wash with 3% BSA in PBS ...
-
bioRxiv - Bioengineering 2021Quote: ... with a QuantStudio 3 qPCR instrument (ThermoFisher). All measurements were repeated in triplicate and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Bioengineering 2021Quote: ... A qPCR machine (Applied Biosystems, QuantStudio 3) was used for running the assay ...
-
bioRxiv - Cell Biology 2021Quote: ... 3–8% Tris-acetate gels (Life Technologies. Proteins were transferred to nitrocellulose membrane by semi-dry transfer (Trans-Blot Turbo transfer system ...
-
bioRxiv - Cell Biology 2021Quote: ... TO-PRO-3 Fluorescent Nuclear Stain (ThermoFisher) was used ...
-
bioRxiv - Microbiology 2020Quote: ... 3 g/L trisodium citrate (Fisher Scientific); 2 g/L KCl (Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... A Haake Mars 3 (Thermo Fisher Scientific) stress-controlled rotational rheometer with Peltier controlled element at 25°C ...
-
bioRxiv - Microbiology 2021Quote: ... in a QuantStudio 3 equipment (ThermoFisher Scientific). ΔΔCT values were calculated in absence or presence of cyanide for the nitrilase genes ykrU and cynD using rpsJ as the normalizing gene ...
-
bioRxiv - Microbiology 2020Quote: ... quantified by Qubit 3 fluorometer 3000 (Invitrogen) and purified by deoxyribonuclease I (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... on a Quant Studio 3 (Applied Biosystems).
-
bioRxiv - Microbiology 2020Quote: ... 3’-(p-hydroxyphenyl) fluorescein (HPF, Life Technologies) (42) ...
-
bioRxiv - Biochemistry 2021Quote: ... using a solution of 3% BSA (ThermoFisher) in TBST (20 mM Tris ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Cancer Biology 2020Quote: The 3’RACE (Invitrogen, Cat # 18373-019) and 5’RACE (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μl Lipofectamine 2000 (Life Technologies 11668027), and 1 μg of plasmid to express the proteins of interest for 4 h after being introduced to the cells ...
-
bioRxiv - Biophysics 2020Quote: 3,3-Diethyloxacarbocyanine iodide (DiOC2(3)) from ThermoFisher Scientific® ...
-
bioRxiv - Biochemistry 2022Quote: ... 3) 1% Pluronic-127 (cat. # P6866, ThermoFisher) in BRB80 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3’-(p-hydroxyphenyl) fluorescein (HPA, H36004, ThermoFisher) or MitoSOX Red (40778ES50 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 µl RNase A (Thermo Fisher Scientific) were added to 200 µl lysate and incubated at 37°C for 10 min before proceeding with co-immunoprecipitation ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 µm particle size (Thermo Fisher Scientific) at 0.3 µL/min using the following gradient of solvent B ...
-
bioRxiv - Systems Biology 2022Quote: ... diluted 1:3 with DPBS (Life Technologies) and 25μL added to the wells ...
-
bioRxiv - Cell Biology 2022Quote: ... or 3-8% Tris Acetate (Invitrogen, EA0375) polyacrylamide gels ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 ng/ml NT-3 (Life technologies) for 8 weeks ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 µl Rnase A (Thermo fisher, EN0531) into the eluate ...
-
bioRxiv - Microbiology 2020Quote: ... quantified by Qubit 3 Broad Range (ThermoFisher) and used as templates for HIV-1 bulk PCR (same methods used for single genome sequencing) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fluo-3-AM (Thermo Fisher Scientific, F23915) was added to the cells and incubated for 30 min in the dark at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a QuantStudio 3 machine (Applied Biosystems). Results were analyzed using the 2−ddCt method and calculated as relative to HPRT expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... with 3% fetal bovine serum (Gibco, 10270), 100 U/ml penicillin with 100 µg/ml streptomycin (Gibco ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.25 uL of Dharmafect #3 (Thermo Fisher) was used per well ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 μl Lipofectamine RNAiMAX Reagent (Invitrogen) was used as a transfection reagent ...