Labshake search
Citations for Thermo Fisher :
7951 - 8000 of 10000+ citations for Monkey Caveolin 1 CAV1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 50 μl of Dynabeads protein G slurry (#10004D, Thermo Fisher) per ChIP sample was added and incubated rotating for another 2 hours at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transfection with purified plasmid using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the gel stained with Imperial Protein Stain (Thermo Fisher Scientific) and a gel slice with the corresponding HFGF-CD59 protein excised.
-
bioRxiv - Molecular Biology 2020Quote: ... and protein was quantified by Pierce BCA assay kit (ThermoFisher). 4 µg protein was resolved on NuPAGE 4-12% Bis-Tris protein gels (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... pre-cleared with agarose beads conjugated with protein A (ThermoFisher) and then incubated with polyclonal rabbit Ab to BATF3 or NF-kB p65 ...
-
bioRxiv - Immunology 2020Quote: ... were used to visualize proteins using chemiluminescence (PI32106; Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: ... 30-50 ul of Protein G Dynabeads (Invitrogen, cat# 10004D) were aliquoted into each ChIP tube ...
-
bioRxiv - Immunology 2020Quote: ... and protein contents were determined by BCA assay (Thermo Scientific). In some cases ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were separated in either 4–12% NuPAGE gels (ThermoFisher) or in custom 10% polyacrylamide gels and transferred to nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were placed in PFHMII protein free medium (GIBCO, ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Dynabeads™ Protein G were obtained from Life Technologies (10003D). Gelatin Type B from bovine skin was from Sigma (G-9382) ...
-
bioRxiv - Cell Biology 2021Quote: ... Bicinchoninic acid (BCA) protein assay kit was from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein concentrations were measured using Bradford Assay (ThermoFisher, cat# 23200). Antibodies used in this study are as follows ...
-
bioRxiv - Genetics 2019Quote: ... Protein identification used the Sequest software program (Thermo Fisher Scientific) to match the fragmentation pattern of tryptic peptides to the C ...
-
bioRxiv - Genomics 2021Quote: ... was coupled to Dynabeads protein G (Thermo Fisher Scientific, 10009D) for 2 hours at 4°C for each sample ...
-
bioRxiv - Genomics 2021Quote: ... 25 µl of Protein A DynaBeads (Thermo Fisher Scientific 10002D) and 1 µl of H3K27ac antibody (Active Motif ...
-
bioRxiv - Neuroscience 2021Quote: ... A Micro BCA protein assay kit (500-0116; Thermo Scientific) was used to determine the protein concentration and 25μg of cell lysates were heated for 5 minutes at 95°C to denature all proteins ...
-
bioRxiv - Genetics 2020Quote: ... 25 µl of Dynabeads™ Protein G (Thermo Fisher Scientific) were then added to cell lysates and rotated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... was coupled to magnetic Dynabeads Protein G (Thermo Fisher Scientific). An amount of 1.5 mg of beads pellet per sample was resuspended in 200 µL PBS-T (0.02 % Tween20 ...
-
bioRxiv - Microbiology 2020Quote: ... and then supplemented with 50% Protein Stabilizing Cocktail (ThermoFisher Scientific) before storing at -70°C ...
-
bioRxiv - Biophysics 2021Quote: ... lysed using bacterial protein extraction agents (B-PER, ThermoFisher Scientific) in the presence of lysozyme ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted protein was treated with SUMO protease (Invitrogen, Beijing). Then the SUMO digested protein was further purified by a HiTrap Heparin column (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: ... Peptide concentration was quantified using CBQCA protein quantitation kit (Invitrogen) as per manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were biotinylated using NHS-PEG4-Biotin (Thermo Scientific, USA) following the manufacturer recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... After protein concentrations were measured using BCA reagents (Thermo Fisher), bromophenol blue and DTT were added to the supernatants ...
-
bioRxiv - Developmental Biology 2022Quote: ... proteins were transferred to PVDF membrane (Fisher Scientific, Cat# IPFL00010) in western transfer buffer (25 mM Tris ...
-
bioRxiv - Immunology 2022Quote: ... and recombinant proteins were purified using Ni-NTA agarose (ThermoFisher), then buffer exchanged into phosphate buffered saline (PBS ...
-
bioRxiv - Immunology 2022Quote: ... or AF-488 conjugated protein G (Thermo Fisher, Waltham, MA), and analyzed by flow cytometry.
-
bioRxiv - Cancer Biology 2022Quote: ... The Pierce BCA Protein Assay Kit (89167-794, Thermo Scientific) was used to determine protein concentration ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentration was determined using Pierce BCA Assay (Thermo Fisher) and equal amounts of protein were incubated with 25 uL RFP-Trap magnetic agarose rotating for 1 hour at 4°C (Proteintech ...
-
bioRxiv - Developmental Biology 2022Quote: ... The proteins were then transferred to ImmunBlot PVDF membranes (ThermoFisher) for antibody probing ...
-
bioRxiv - Immunology 2022Quote: ... Protein concentration was determined by BCA assay (23225, Thermo Fisher) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... along with PageRuler Prestained protein ladder (Cat. #26619, Thermo Scientific) and proteins were transferred onto a PVDF membrane (Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pre-diluted Protein Assay Standards (Cat. #23208, Thermo Scientific) as per manufacturer’s instruction ...
-
bioRxiv - Genomics 2022Quote: ... Lysates were precleared using Protein G Sepharose (Thermo Fisher Scientific) for 1 h prior to an overnight incubation at 4 °C with either anti-SRSF3 or anti-SRSF3-TR antibody ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were processed in parallel in Protein LoBind tubes (ThermoFisher). Each 15 cm dish resulted in approximately 1.2 ml cell suspension ...
-
Co-stimulatory molecules decide T cell fate through regulations of their invigoration and impairmentbioRxiv - Molecular Biology 2022Quote: ... gRNA (CD28: TCGGCATTCGAGCGAAACTG, ICOS: AGGTTCCTTTCTTGAAAAGG) with Cas9 protein (Thermo Fisher) was incubated for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Separated proteins were then transferred to nitrocellulose membranes (Thermo Scientific) using the iBlot 2 Dry Blotting System (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Lysates were pre-cleared with Protein A dynabeads (Invitrogen, 10002D) + IgG under rotary agitation for 45 min at 4ºC ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complexes were collected with protein G-dynabeads (Thermo Fisher Scientific) for 2h at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... antibody capture was performed with Protein A Dynabeads (Invitrogen, 10001D) for 2 hours on a rotator at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were quantified using the BCA method (Pierce, ThermoFisher Scientific) and then 30-50 μg of proteins were loaded on 8-12 % polyacrylamide gels for SDS-PAGE ...
-
bioRxiv - Cancer Biology 2022Quote: ... previously bound with Dynabeads protein G magnetic beads (Life Technologies). Then ...
-
bioRxiv - Cancer Biology 2022Quote: Protein concentration was determined using the BCA assay (ThermoFisher, #23227). Nu-PAGE SDS-PAGE (4–12% gradient ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were detected using enhanced chemiluminescence reagents (Thermo Scientific #34095) and imaged on the PVDF membrane (Thermo Scientific #88518 ...
-
bioRxiv - Cancer Biology 2022Quote: Total proteins were extracted using RIPA buffer (ThermoFisher Scientific, 89901) supplemented with protease and phosphatase inhibitor cocktails (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 25μL Protein G Dynabeads™ (Invitrogen, 10004D, lot no. 01013573) were washed thrice with cell lysis buffer ...
-
bioRxiv - Biophysics 2022Quote: ... 25 µL of Protein A coated magnetic beads (Invitrogen, 10008D) were washed once with binding buffer and incubated with either 0 ...
-
bioRxiv - Biophysics 2022Quote: ... Protein concentrations were measured by NanoDrop One (Thermo Fisher Scientific) based on the absorbance of fluorophores.
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were quantified using the BCA method (ThermoFisher Scientific, 23227). A total of 16 μg of proteins were loaded and separated on 4-12% polyacrylamide-SDS gels under reducing conditions (Invitrogen ...