Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for beta Tubulin III Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... and reversed transcribed using Superscript III (Invitrogen, 18080093) and random hexamers (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized with SuperScript III (Invitrogen/ThermoFisher) and oligodT according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... it was retrotranscribed by Super-Script III (Invitrogen) using random hexanucleotides as primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized with SuperScript III (Invitrogen/ThermoFisher) and oligodT according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... RNA was reverse transcribed with SuperScript III (Invitrogen) with the RT primer 5’ CCTTGGCACCCGAGAATTCCA ...
-
bioRxiv - Genomics 2020Quote: ... followed by reverse transcription with Superscript III (Invitrogen) using dT(20 ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.25μl SuperScript III Reverse Transcriptase (Life Technologies) were incubated for 30 min at 42°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was reverse transcribed with Superscript III (Invitrogen) into cDNA using the BGH reverse primer in the vector (5’-tagaaggcacagtcgagg-3’) ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized using Superscript III kit (Invitrogen). Real time quantitative PCR was performed using SYBR Green (Kapa Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... reversed transcribed using Super Script-III kit (Invitrogen), and analyzed using SYBRgreen (ABgene ...
-
bioRxiv - Cancer Biology 2019Quote: ... SuperScript III reverse transcriptase (Thermo Fisher Scientific, 18080044) was used ...
-
bioRxiv - Immunology 2019Quote: ... RNA was reverse transcribed using Superscript III (Invitrogen) and a barcoded primer specific to each 500bp sub-amplicon in the HA (Primer ID) ...
-
bioRxiv - Genomics 2019Quote: ... 2) We used SuperScript III (Thermo Fisher Scientific) in place of SuperScript II and performed reverse transcription at 55 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the Superscript III reverse transcriptase kit (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Extension reactions with 250U Superscript III (Thermo Fisher) were performed for 5 minutes at 25°C ...
-
bioRxiv - Plant Biology 2019Quote: ... and cDNA was generated using SuperScript III (Invitrogen) with random hexamers according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... (iii) 0.5 mg/ml NeutrAvidin (31000; Thermo Fisher), (iv ...
-
bioRxiv - Cell Biology 2021Quote: ... and cDNA was synthesised using SuperScript III (Invitrogen) according to manufacturer instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... cDNA was prepared using SuperScript RT III (Invitrogen) with oligo dT primers ...
-
bioRxiv - Physiology 2021Quote: ... with Superscript III First-Strand Synthesis System (Invitrogen). The cDNA synthesis protocol was performed in two steps ...
-
bioRxiv - Microbiology 2021Quote: ... SuperScript III reverse transcriptase and random primers (Invitrogen) were used to perform reverse transcription ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript™ III reverse transcriptase (Thermo Fisher Scientific) was used to produce cDNA from viral RNA using a primer (pLAI-JRFL-NefOR-rev ...
-
bioRxiv - Microbiology 2020Quote: ... the Superscript III First Strand synthesis kit (Invitrogen) was used following manufacturer’s recommended protocols ...
-
bioRxiv - Neuroscience 2020Quote: Complementary DNA was synthesized by Superscript III (Invitrogen) reverse transcriptase with the addition of Ribolock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... using the SuperScript III Reverse Transcriptase (ThermoFisher, #18080093) or Superscript VILO cDNA master mix (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cDNA was synthesized using Superscript III (Invitrogen) according to the manufactures’ instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... FFPE sections were stained with Hematoxylin and Eosin and-scanned by Thermo Fisher (Panoramic 250 Flash III, Thermo Fisher, Tewksbury, MA) scanner and adipocyte area of N=50 adipocytes were quantified using software (Case Viewer ...
-
bioRxiv - Biochemistry 2022Quote: ... equipped with a Falcon III detector (Thermofisher Scientific). Typically ...
-
bioRxiv - Microbiology 2022Quote: ... Following the Superscript III reverse transcriptase protocol (Invitrogen), equal amounts of total RNA (1 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... and cDNA was synthesised using Superscript III (Invitrogen). RT-PCR was used to confirm the absence of full-length transcripts in the T-DNA mutants using the primers listed in Supplementary Table S1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SuperScript III reverse transcriptase (Thermo Fisher Scientific) was used for cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... equipped with a Falcon III (Thermo Fisher Scientific) direct electron detector ...
-
bioRxiv - Developmental Biology 2022Quote: ... for mature miR-9 or SuperScript III (Invitrogen) with random hexamers for pri-miRNAs ...
-
bioRxiv - Cell Biology 2022Quote: ... and SuperScript III Reverse Transcriptase (18080044, Thermo Fisher). Following amplification of the XBP1 transcript of the resulting cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed with Superscript III (Invitrogen) and random hexamers according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... was performed using SuperScript III (Invitrogen, 18080-044). QPCR was performed using EvaGreen Hot FirePol qPCR Mix Plus (Solis Biodyne ...
-
bioRxiv - Developmental Biology 2020Quote: ... and cDNA was synthesized using SuperScript III (Invitrogen). HH39 mandibles were first frozen with liquid nitrogen and ground using a mortar and pestle to ensure homogenous extraction from bone ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was created using Superscript III (Thermo Fisher), and then IFIT1 was amplified by PCR ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of SuperScript III reverse transcriptase (Invitrogen), and incubated at 50°C for 1 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Complementary DNA was generated using Superscript III (Invitrogen) and random hexamers ...
-
bioRxiv - Genetics 2020Quote: ... and cDNA prepared by Superscript III (ThermoFisher #18080044), prior to qPCR analysis ...
-
bioRxiv - Genetics 2019Quote: ... and cDNA prepared by Superscript III (ThermoFisher #18080044), prior to qPCR analysis ...
-
bioRxiv - Genetics 2022Quote: ... cDNA was prepared with Superscript III from Invitrogen. qPCR experiments utilized a Real-Time PCR StepOnePlus system from Applied Biosystems and SYBR green ...
-
bioRxiv - Molecular Biology 2022Quote: cDNA was synthesized using Superscript III (Thermo Scientific). qPCR on cDNA derived from nuclear pre-mRNAs or cytoplasmic mRNAs was performed using 2 x Power Sybrgreen Master Mix (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) in a 20-μL reaction mixture ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: Reverse transcription was performed with SuperScript III (Invitrogen) with 100 to 400 ng RNA per reaction ...
-
bioRxiv - Microbiology 2019Quote: ... 1 μL of SuperScript III reverse transcriptase (Invitrogen), and incubated at 50°C for 1 h ...
-
bioRxiv - Neuroscience 2020Quote: ... and reverse transcription with Superscript III (ThermoFisher, 18080051). In order to generate the GlyT1 antisense probe ...
-
bioRxiv - Cancer Biology 2019Quote: ... SuperScript III reverse transcriptase (18080044, lot #2042663, Invitrogen) and the flourophore labeled PE_1248_FAM primer were added for primer annealing and RT (1h at 50°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA synthesis was performed using SuperScript III (Invitrogen) and random hexamers ...