Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for Recombinant Rabbit FGF2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing colon organoids ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... the membranes were probed with anti-TasA antibody (rabbit) used at a 1:20,000 dilution in Pierce Protein-Free (TBS) blocking buffer (ThermoFisher). For immunodtection of FloT-YFP ...
-
bioRxiv - Cell Biology 2019Quote: ... Anti-PRG-1 antibody (Custom) or rabbit IgG was pre-coupled to protein A/G matrix (Thermo Scientific, 88802) and incubated with the supernatant of worm lysates for 4 h (Anti-PRG-1 with N2 lysates ...
-
bioRxiv - Cell Biology 2019Quote: ... The polyclonal anti-EhPKDL antibody used was raised in rabbit and subsequently purified with Protein A-Sepharose (Invitrogen, USA). Dilutions of antibody used were ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-H3K27Ac antibody or rabbit IgG antibody was conjugated to the Dynabeads™ protein G beads (Thermo Fisher Scientific). Chromatins (15 ug ...
-
bioRxiv - Immunology 2021Quote: ... IgG was purified from immunized rabbit serum using Pierce™ Protein A IgG Purification Kit (ThermoFisher, cat. No. 44667) and dialyzed against PBS ...
-
bioRxiv - Microbiology 2020Quote: ... 2µg rabbit anti-Msr1 IgG was cross-linked to 50µl of protein A/G agarose beads (ThermoFisher Cat# 20421) with dimethyl pimelimidate (ThermoFisher Cat# 21666) ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were visualized by incubation in 1 in 50,000 dilution of HRP-conjugated goat anti-rabbit IgG (Life Technologies) for one hour followed by Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... mouse monoclonal or anti-GFP rabbit polyclonal (ab290) antibody was incubated with Protein-G/A magnetic beads (Dynabeads, Invitrogen) in PBST for 2hrs at 4 °C ...
-
bioRxiv - Genomics 2021Quote: Co-IPs were performed with 200µg of nuclear protein extract that was pre-cleared with α-rabbit Dynabeads (Invitrogen) for 1 hour in IP buffer (20 mM Tris pH 8 ...
-
bioRxiv - Neuroscience 2022Quote: ... Sheared chromatin was incubated with anti-CEBPG or anti-rabbit IgG control antibody attached to protein A Dynabeads (Invitrogen) and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... the slices were incubated with anti-green fluorescent protein rabbit IgG primary antibody (1:1000; Molecular Probes, OR, USA) and anti-Tyrosine Hydroxylase (TH ...
-
bioRxiv - Microbiology 2024Quote: ... For the SARS-CoV-2 staining a polyclonal rabbit anti-SARS Coronavirus Spike protein (PA1-41142, Thermo Fisher, France) and revealed using an anti-rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2024Quote: ... Detection of the specific protein signal was achieved by using WesternBreeze Chemiluminescent (anti-rabbit or anti-mouse) kit (Invitrogen) or by using Immobilon Forte Western HRP substrate (Merck)
-
bioRxiv - Cell Biology 2024Quote: ... For protein detection secondary anti-mouse or anti-rabbit antibodies conjugated either to Alexa Fluor 488 and 555 (Invitrogen) for immunofluorescence or to horseradish peroxidase (HRP ...
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen), which was detected using an ECL Advance Western Blotting Detection Kit (Amersham ...
-
bioRxiv - Molecular Biology 2020Quote: Recombinant 6x-His tagged PTB was purified using Ni-NTA agarose (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Recombinant BUD13 purification was confirmed by SimplyBue SafeStain (Thermo Fisher Scientific, LC6060) and western blot using BUD13 antibody (Bethyl Laboratories ...
-
bioRxiv - Immunology 2019Quote: ... slices were overlaid with 50ng recombinant IL-15/IL-15Rαcomplex (Thermo Fisher) in 10□1 of cRPMI following peptide treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant virus was made by co-transfection into SF9 insect cells (Invitrogen) of the plasmid and BacVector3000 baculovirus DNA (Novagen ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2) 1 U/μL RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific). Hydra polyps in MCB buffer were homogenized on ice using a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2019Quote: ... and 20 ng/mL recombinant human fibroblast growth factor-basic (Life Technologies). After 3 to 6 weeks ...
-
bioRxiv - Immunology 2019Quote: ... recombinant macrophage colony-stimulating factor (100 U/ml; ebioscience, Thermo Fisher Scientific) and Pen Strep (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 ng/ml recombinant mouse macrophage colony-stimulating factor (Gibco, Burlington, ON), and penicillin/streptomycin antibiotics ...
-
bioRxiv - Microbiology 2021Quote: ... 20 ng/ml of recombinant human epidermal growth factor (EGF, Life Technologies), human insulin (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant plasmid was linearized using the Ncol restriction enzyme (ThermoFisher Scientific) and the MEGAscript® T7 Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and 20 U/ml recombinant interleukin-2 (IL-2; Thermo Fisher Scientific) at 37° C ...
-
bioRxiv - Microbiology 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac expression system (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: HESCs were routinely maintained on recombinant VTN-N Vitronectin (A14700, Life Technologies), also tested on the prototype CTS™ (Cell Therapy Systems ...
-
bioRxiv - Immunology 2022Quote: ... media was additionally supplemented with recombinant murine IL-12p70 (Thermo Fisher Scientific) and recombinant murine IL-18 (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2020Quote: ... The recombinant plasmids were extracted with PureLink Quick Plasmid Miniprep Kit (Invitrogen) from successful clones.
-
bioRxiv - Biochemistry 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac system (ThermoFisher Scientific), and sNrk was expressed in Sf9 cells grown in ESF921 medium (Expression Systems) ...
-
bioRxiv - Immunology 2021Quote: The recombinant baculovirus was amplified in Sf9 cells (Thermo Fisher Scientific, USA) to a density of 2 × 106 cells/mL in ExCell 420 medium (Sigma Aldrich ...
-
bioRxiv - Biophysics 2019Quote: Recombinant APC/C was expressed in High Five insect cells (Thermo Scientific) as described in30,42 ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant bacmids were obtained from Bac-to-Bac system (Life Technologies). Baculoviruses were produced by transfection of bacmid DNA into Sf9 cells and used to infect High Five cells (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 ng/ml recombinant human basic fibroblast growth factor (Invitrogen, Waltham, MA) (hiPSC medium).
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were carried out using Recombinant Taq DNA Polymerase (Thermo Scientific) and standard PCR cycling conditions.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant SARS-CoV-2 RBD were purified by nickel affinity columns (Invitrogen) while ACE2-Fc and antibodies were purified by protein A affinity columns (Cytiva ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were used to generate recombinant bacmids according to the manufacturer’s protocol (Invitrogen). Insertion of the gene into the bacmid was verified by PCR ...
-
bioRxiv - Physiology 2020Quote: ... and 2.5 ng/ml recombinant human hepatocyte growth factor (Gibco, Loughborough, UK). Skeletal muscle myoblasts were incubated at 37°C in a humidified atmosphere of 5% CO2 until 80% confluence ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant bacmid was transfected into Sf9 insect cells using Lipofectamine (Invitrogen) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant plasmids were transformed into INVSc1 Saccharomyces cerevisiae (Thermo Fisher Scientific) using the PEG-LiAc method ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA). 2 μL of ten-fold diluted RNA template in duplicates was added in a total volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) was used ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was diluted to 2.5 μg/mL in PBS (Fisher Scientific) and 100 μl of the dilution was distributed in the wells of flat-bottom 96-well microplates (Immulon 2HB ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant human EGF used in this study was from Thermo Fisher Scientific and the recombinant human HGF was generously provided by Drs ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...